Incidental Mutation 'R8686:Fbxo18'
ID662020
Institutional Source Beutler Lab
Gene Symbol Fbxo18
Ensembl Gene ENSMUSG00000058594
Gene NameF-box protein 18
SynonymsFbx18
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.321) question?
Stock #R8686 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location11742573-11777582 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 11755658 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 694 (V694I)
Ref Sequence ENSEMBL: ENSMUSP00000071495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071564] [ENSMUST00000131893]
Predicted Effect probably benign
Transcript: ENSMUST00000071564
AA Change: V694I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000071495
Gene: ENSMUSG00000058594
AA Change: V694I

DomainStartEndE-ValueType
FBOX 213 256 3.94e-3 SMART
Pfam:UvrD-helicase 626 692 8e-10 PFAM
Pfam:UvrD_C 862 935 1.7e-12 PFAM
Pfam:UvrD_C_2 867 931 1.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131893
AA Change: V109I

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000116392
Gene: ENSMUSG00000058594
AA Change: V109I

DomainStartEndE-ValueType
SCOP:d1pjr_1 63 141 5e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family, members of which are characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into three classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbx class. It contains an F-box motif and seven conserved helicase motifs, and has both DNA-dependent ATPase and DNA unwinding activities. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik C T 9: 103,259,428 A525T probably benign Het
Adam25 A G 8: 40,755,484 T596A probably benign Het
Adamts6 A G 13: 104,313,699 I303V probably damaging Het
Alpl A T 4: 137,743,801 H341Q probably damaging Het
Cachd1 G A 4: 100,988,128 R939H probably damaging Het
Ccdc114 A G 7: 45,947,692 T456A probably benign Het
Cd22 G A 7: 30,870,069 R541C probably benign Het
Cenpf A T 1: 189,659,604 M660K probably benign Het
Cmya5 A T 13: 93,095,380 S1067T possibly damaging Het
Col5a2 C T 1: 45,421,987 G250D probably damaging Het
Cylc2 C T 4: 51,229,651 T331M unknown Het
Dgka A G 10: 128,733,093 M201T probably benign Het
Dnajc13 T C 9: 104,170,805 I1804V probably benign Het
Dym T A 18: 75,286,683 Y642N probably damaging Het
Efr3b A T 12: 4,000,886 D26E probably damaging Het
Emilin1 A T 5: 30,917,696 K427M possibly damaging Het
Fam187b T C 7: 30,977,234 L56S probably benign Het
Fgd2 C T 17: 29,379,023 T644I probably benign Het
G6pc T G 11: 101,374,707 probably null Het
Gli2 A G 1: 118,836,687 S1245P probably benign Het
Gm10696 T C 3: 94,176,120 D128G probably benign Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Ighv1-84 T C 12: 115,980,904 D50G probably benign Het
Impdh1 C A 6: 29,216,215 probably benign Het
Irf4 A T 13: 30,761,450 D393V possibly damaging Het
Kalrn A G 16: 34,360,935 L111P probably damaging Het
Lrch3 T C 16: 32,981,853 V58A possibly damaging Het
Lrif1 C T 3: 106,732,781 T394I probably damaging Het
Map4k1 A G 7: 28,994,073 T434A probably benign Het
Mcur1 G A 13: 43,541,717 T327M probably damaging Het
Mettl7b A T 10: 128,960,607 M111K possibly damaging Het
Myo9b G T 8: 71,334,322 S716I probably benign Het
Nol10 T A 12: 17,369,771 probably benign Het
Nos3 A G 5: 24,368,843 T202A possibly damaging Het
Olfr128 T C 17: 37,924,277 V237A probably benign Het
Olfr710 A C 7: 106,944,698 M101R probably benign Het
Parp12 A T 6: 39,117,922 S80T probably benign Het
Pde1a C T 2: 79,927,742 V50I probably benign Het
Pfkl A T 10: 77,997,522 probably null Het
Phkg1 A T 5: 129,866,215 Y207N probably damaging Het
Pik3r4 A G 9: 105,658,529 T640A possibly damaging Het
Pip5k1c C A 10: 81,311,993 H411N probably damaging Het
Pla2g4e A G 2: 120,244,691 S73P probably damaging Het
Polr2b T C 5: 77,335,663 V662A probably damaging Het
Prss43 C T 9: 110,829,426 R265C possibly damaging Het
Rap1b A T 10: 117,822,841 V29D probably damaging Het
Rraga A G 4: 86,576,811 E298G probably damaging Het
Rrp8 A T 7: 105,733,574 I418N probably damaging Het
Siglecf T C 7: 43,355,606 V420A probably benign Het
Snx14 T A 9: 88,415,693 N174I probably damaging Het
Speer4e T C 5: 14,934,115 N229S probably benign Het
Teddm3 A G 16: 21,152,935 *295Q probably null Het
Tfap2c A G 2: 172,552,006 D245G possibly damaging Het
Tfap2d A G 1: 19,108,284 N191S probably benign Het
Unc80 A G 1: 66,612,268 R1591G possibly damaging Het
Vmn1r116 T C 7: 20,872,691 W146R probably damaging Het
Vps13b C G 15: 35,925,389 S3823R probably damaging Het
Wiz T A 17: 32,367,847 D163V probably damaging Het
Xylt1 G C 7: 117,381,359 A61P unknown Het
Zfp521 A C 18: 13,845,644 F571V probably damaging Het
Zfp664 T A 5: 124,886,069 C176S possibly damaging Het
Zfyve26 T C 12: 79,287,453 N264D probably benign Het
Other mutations in Fbxo18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01615:Fbxo18 APN 2 11757523 nonsense probably null
IGL02081:Fbxo18 APN 2 11764127 missense probably benign 0.31
IGL02082:Fbxo18 APN 2 11764127 missense probably benign 0.31
IGL02084:Fbxo18 APN 2 11764127 missense probably benign 0.31
IGL02086:Fbxo18 APN 2 11764127 missense probably benign 0.31
IGL02369:Fbxo18 APN 2 11747158 missense possibly damaging 0.61
IGL02584:Fbxo18 APN 2 11759958 missense probably benign 0.07
IGL03138:Fbxo18 UTSW 2 11749509 intron probably benign
R0384:Fbxo18 UTSW 2 11749578 missense probably damaging 1.00
R0479:Fbxo18 UTSW 2 11758419 missense probably damaging 1.00
R0972:Fbxo18 UTSW 2 11764088 splice site probably benign
R1420:Fbxo18 UTSW 2 11767682 missense probably benign 0.01
R1827:Fbxo18 UTSW 2 11763888 missense possibly damaging 0.88
R1832:Fbxo18 UTSW 2 11767400 missense probably benign 0.08
R1960:Fbxo18 UTSW 2 11757528 missense probably damaging 0.98
R2040:Fbxo18 UTSW 2 11769895 missense possibly damaging 0.66
R2044:Fbxo18 UTSW 2 11762970 missense possibly damaging 0.89
R2102:Fbxo18 UTSW 2 11758289 missense probably benign 0.18
R3236:Fbxo18 UTSW 2 11769826 missense probably damaging 1.00
R3975:Fbxo18 UTSW 2 11767210 missense possibly damaging 0.72
R4504:Fbxo18 UTSW 2 11749017 missense possibly damaging 0.91
R4505:Fbxo18 UTSW 2 11749017 missense possibly damaging 0.91
R4507:Fbxo18 UTSW 2 11749017 missense possibly damaging 0.91
R4799:Fbxo18 UTSW 2 11755747 missense probably damaging 1.00
R4894:Fbxo18 UTSW 2 11762960 missense probably damaging 1.00
R4994:Fbxo18 UTSW 2 11764230 missense probably damaging 1.00
R5579:Fbxo18 UTSW 2 11748993 missense probably damaging 0.97
R5801:Fbxo18 UTSW 2 11769826 missense probably damaging 1.00
R6255:Fbxo18 UTSW 2 11748446 missense probably benign 0.31
R7011:Fbxo18 UTSW 2 11762963 missense probably damaging 1.00
R7177:Fbxo18 UTSW 2 11755711 missense probably damaging 1.00
R7243:Fbxo18 UTSW 2 11751525 missense probably benign 0.11
R7331:Fbxo18 UTSW 2 11763986 missense probably benign
R7361:Fbxo18 UTSW 2 11747076 missense probably damaging 1.00
R7460:Fbxo18 UTSW 2 11756685 missense probably benign 0.38
R7541:Fbxo18 UTSW 2 11749537 missense probably benign 0.05
R8000:Fbxo18 UTSW 2 11767289 missense probably benign 0.21
R8010:Fbxo18 UTSW 2 11767632 missense probably benign 0.15
R8056:Fbxo18 UTSW 2 11743630 missense probably benign 0.01
R8517:Fbxo18 UTSW 2 11777430 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CAACATGAATGACCTGTGGC -3'
(R):5'- AAGAAATTATTGTCTGTCGTGGGC -3'

Sequencing Primer
(F):5'- CATGAATGACCTGTGGCTTTATC -3'
(R):5'- AGATATGGCTTATTTTCGCTGC -3'
Posted On2021-03-08