Incidental Mutation 'R8686:Pde1a'
ID 662021
Institutional Source Beutler Lab
Gene Symbol Pde1a
Ensembl Gene ENSMUSG00000059173
Gene Name phosphodiesterase 1A, calmodulin-dependent
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_001159582, NM_016744, NM_001009978, NM_001009979

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8686 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 79834453-80129458 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 79927742 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 50 (V50I)
Ref Sequence ENSEMBL: ENSMUSP00000099713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102653] [ENSMUST00000102654] [ENSMUST00000102655] [ENSMUST00000183775]
AlphaFold Q61481
Predicted Effect probably benign
Transcript: ENSMUST00000102653
AA Change: V50I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099713
Gene: ENSMUSG00000059173
AA Change: V50I

DomainStartEndE-ValueType
Pfam:PDEase_I_N 73 133 1.2e-31 PFAM
HDc 216 380 5.19e-7 SMART
low complexity region 448 461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102654
AA Change: V50I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099714
Gene: ENSMUSG00000059173
AA Change: V50I

DomainStartEndE-ValueType
Pfam:PDEase_I_N 73 133 1.2e-31 PFAM
HDc 216 380 5.19e-7 SMART
low complexity region 448 461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102655
AA Change: V50I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099715
Gene: ENSMUSG00000059173
AA Change: V50I

DomainStartEndE-ValueType
Pfam:PDEase_I_N 73 133 7.8e-35 PFAM
HDc 216 380 5.19e-7 SMART
low complexity region 448 461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134739
AA Change: V17I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120188
Gene: ENSMUSG00000059173
AA Change: V17I

DomainStartEndE-ValueType
Pfam:PDEase_I_N 41 101 1.4e-35 PFAM
HDc 184 348 5.19e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183775
AA Change: V50I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000139327
Gene: ENSMUSG00000059173
AA Change: V50I

DomainStartEndE-ValueType
Pfam:PDEase_I_N 73 133 1.2e-31 PFAM
HDc 216 380 5.19e-7 SMART
low complexity region 448 461 N/A INTRINSIC
Meta Mutation Damage Score 0.0975 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cyclic nucleotide phosphodiesterases (PDEs) play a role in signal transduction by regulating intracellular cyclic nucleotide concentrations through hydrolysis of cAMP and/or cGMP to their respective nucleoside 5-prime monophosphates. Members of the PDE1 family, such as PDE1A, are Ca(2+)/calmodulin (see CALM1; MIM 114180)-dependent PDEs (CaM-PDEs) that are activated by calmodulin in the presence of Ca(2+) (Michibata et al., 2001 [PubMed 11342109]; Fidock et al., 2002 [PubMed 11747989]).[supplied by OMIM, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik C T 9: 103,259,428 A525T probably benign Het
Adam25 A G 8: 40,755,484 T596A probably benign Het
Adamts6 A G 13: 104,313,699 I303V probably damaging Het
Alpl A T 4: 137,743,801 H341Q probably damaging Het
Cachd1 G A 4: 100,988,128 R939H probably damaging Het
Ccdc114 A G 7: 45,947,692 T456A probably benign Het
Cd22 G A 7: 30,870,069 R541C probably benign Het
Cenpf A T 1: 189,659,604 M660K probably benign Het
Cmya5 A T 13: 93,095,380 S1067T possibly damaging Het
Col5a2 C T 1: 45,421,987 G250D probably damaging Het
Cylc2 C T 4: 51,229,651 T331M unknown Het
Dgka A G 10: 128,733,093 M201T probably benign Het
Dnajc13 T C 9: 104,170,805 I1804V probably benign Het
Dym T A 18: 75,286,683 Y642N probably damaging Het
Efr3b A T 12: 4,000,886 D26E probably damaging Het
Emilin1 A T 5: 30,917,696 K427M possibly damaging Het
Fam187b T C 7: 30,977,234 L56S probably benign Het
Fbxo18 C T 2: 11,755,658 V694I probably benign Het
Fgd2 C T 17: 29,379,023 T644I probably benign Het
G6pc T G 11: 101,374,707 probably null Het
Gli2 A G 1: 118,836,687 S1245P probably benign Het
Gm10696 T C 3: 94,176,120 D128G probably benign Het
Gpr137b T C 13: 13,359,406 Y355C Het
Ighv1-84 T C 12: 115,980,904 D50G probably benign Het
Impdh1 C A 6: 29,216,215 probably benign Het
Irf4 A T 13: 30,761,450 D393V possibly damaging Het
Kalrn A G 16: 34,360,935 L111P probably damaging Het
Lrch3 T C 16: 32,981,853 V58A possibly damaging Het
Lrif1 C T 3: 106,732,781 T394I probably damaging Het
Map4k1 A G 7: 28,994,073 T434A probably benign Het
Mcur1 G A 13: 43,541,717 T327M probably damaging Het
Mettl7b A T 10: 128,960,607 M111K possibly damaging Het
Myo9b G T 8: 71,334,322 S716I probably benign Het
Nol10 T A 12: 17,369,771 probably benign Het
Nos3 A G 5: 24,368,843 T202A possibly damaging Het
Olfr128 T C 17: 37,924,277 V237A probably benign Het
Olfr710 A C 7: 106,944,698 M101R probably benign Het
Parp12 A T 6: 39,117,922 S80T probably benign Het
Pfkl A T 10: 77,997,522 probably null Het
Phkg1 A T 5: 129,866,215 Y207N probably damaging Het
Pik3r4 A G 9: 105,658,529 T640A possibly damaging Het
Pip5k1c C A 10: 81,311,993 H411N probably damaging Het
Pla2g4e A G 2: 120,244,691 S73P probably damaging Het
Polr2b T C 5: 77,335,663 V662A probably damaging Het
Prss43 C T 9: 110,829,426 R265C possibly damaging Het
Rap1b A T 10: 117,822,841 V29D probably damaging Het
Rraga A G 4: 86,576,811 E298G probably damaging Het
Rrp8 A T 7: 105,733,574 I418N probably damaging Het
Siglecf T C 7: 43,355,606 V420A probably benign Het
Snx14 T A 9: 88,415,693 N174I probably damaging Het
Speer4e T C 5: 14,934,115 N229S probably benign Het
Teddm3 A G 16: 21,152,935 *295Q probably null Het
Tfap2c A G 2: 172,552,006 D245G possibly damaging Het
Tfap2d A G 1: 19,108,284 N191S probably benign Het
Unc80 A G 1: 66,612,268 R1591G possibly damaging Het
Vmn1r116 T C 7: 20,872,691 W146R probably damaging Het
Vps13b C G 15: 35,925,389 S3823R probably damaging Het
Wiz T A 17: 32,367,847 D163V probably damaging Het
Xylt1 G C 7: 117,381,359 A61P unknown Het
Zfp521 A C 18: 13,845,644 F571V probably damaging Het
Zfp664 T A 5: 124,886,069 C176S possibly damaging Het
Zfyve26 T C 12: 79,287,453 N264D probably benign Het
Other mutations in Pde1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Pde1a APN 2 79865670 missense probably damaging 1.00
IGL01860:Pde1a APN 2 79875284 missense probably damaging 1.00
IGL02059:Pde1a APN 2 79897077 missense possibly damaging 0.64
IGL02307:Pde1a APN 2 79906068 missense possibly damaging 0.70
IGL02376:Pde1a APN 2 79875223 splice site probably benign
IGL02569:Pde1a APN 2 79868258 missense probably benign 0.04
IGL03038:Pde1a APN 2 79887946 splice site probably benign
G5030:Pde1a UTSW 2 79887836 splice site probably benign
R0099:Pde1a UTSW 2 79868313 critical splice acceptor site probably null
R0549:Pde1a UTSW 2 79865070 missense probably damaging 1.00
R0960:Pde1a UTSW 2 79865034 splice site probably benign
R1855:Pde1a UTSW 2 79898064 critical splice donor site probably null
R1907:Pde1a UTSW 2 79868307 missense probably damaging 1.00
R1972:Pde1a UTSW 2 79865721 missense probably damaging 0.99
R2262:Pde1a UTSW 2 80128931 start gained probably benign
R4658:Pde1a UTSW 2 79898181 critical splice acceptor site probably benign
R4674:Pde1a UTSW 2 79898181 critical splice acceptor site probably benign
R4842:Pde1a UTSW 2 80128837 utr 5 prime probably benign
R4878:Pde1a UTSW 2 79878139 missense probably benign 0.05
R5161:Pde1a UTSW 2 79878144 missense probably null 1.00
R5473:Pde1a UTSW 2 79906028 missense probably damaging 1.00
R5940:Pde1a UTSW 2 79887839 critical splice donor site probably null
R5976:Pde1a UTSW 2 79868242 nonsense probably null
R6016:Pde1a UTSW 2 79865062 missense probably benign 0.01
R6242:Pde1a UTSW 2 80128792 missense probably benign
R6248:Pde1a UTSW 2 79878201 missense probably damaging 1.00
R6609:Pde1a UTSW 2 79906140 missense probably damaging 1.00
R6858:Pde1a UTSW 2 80129158 unclassified probably benign
R7161:Pde1a UTSW 2 79865214 missense probably benign 0.00
R8813:Pde1a UTSW 2 80128917 start gained probably benign
R8835:Pde1a UTSW 2 79878178 missense probably damaging 1.00
X0025:Pde1a UTSW 2 79838930 makesense probably null
Z1176:Pde1a UTSW 2 79906028 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGTTTAAGCCTACATAAGTCTTG -3'
(R):5'- CATGAATACGGTTATCATGCTGC -3'

Sequencing Primer
(F):5'- TCTAAGAACAGTGAAGATGAAGAAGC -3'
(R):5'- GCAATACTCCTGAGACATGAATATC -3'
Posted On 2021-03-08