Incidental Mutation 'R8686:Cylc2'
ID 662026
Institutional Source Beutler Lab
Gene Symbol Cylc2
Ensembl Gene ENSMUSG00000039555
Gene Name cylicin, basic protein of sperm head cytoskeleton 2
Synonyms 4930488P18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock # R8686 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 51216678-51230272 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 51229651 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 331 (T331M)
Ref Sequence ENSEMBL: ENSMUSP00000125758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041392] [ENSMUST00000166749]
AlphaFold A0A571BEE2
Predicted Effect unknown
Transcript: ENSMUST00000041392
AA Change: T331M
SMART Domains Protein: ENSMUSP00000039750
Gene: ENSMUSG00000039555
AA Change: T331M

DomainStartEndE-ValueType
Pfam:Cylicin_N 7 115 1.1e-43 PFAM
low complexity region 122 131 N/A INTRINSIC
low complexity region 174 220 N/A INTRINSIC
low complexity region 224 245 N/A INTRINSIC
low complexity region 249 272 N/A INTRINSIC
low complexity region 278 300 N/A INTRINSIC
low complexity region 312 329 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000166749
AA Change: T331M
SMART Domains Protein: ENSMUSP00000125758
Gene: ENSMUSG00000039555
AA Change: T331M

DomainStartEndE-ValueType
Pfam:Cylicin_N 8 113 4.6e-46 PFAM
low complexity region 122 131 N/A INTRINSIC
low complexity region 174 220 N/A INTRINSIC
low complexity region 224 245 N/A INTRINSIC
low complexity region 249 272 N/A INTRINSIC
low complexity region 278 300 N/A INTRINSIC
low complexity region 312 329 N/A INTRINSIC
low complexity region 338 420 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik C T 9: 103,259,428 A525T probably benign Het
Adam25 A G 8: 40,755,484 T596A probably benign Het
Adamts6 A G 13: 104,313,699 I303V probably damaging Het
Alpl A T 4: 137,743,801 H341Q probably damaging Het
Cachd1 G A 4: 100,988,128 R939H probably damaging Het
Ccdc114 A G 7: 45,947,692 T456A probably benign Het
Cd22 G A 7: 30,870,069 R541C probably benign Het
Cenpf A T 1: 189,659,604 M660K probably benign Het
Cmya5 A T 13: 93,095,380 S1067T possibly damaging Het
Col5a2 C T 1: 45,421,987 G250D probably damaging Het
Dgka A G 10: 128,733,093 M201T probably benign Het
Dnajc13 T C 9: 104,170,805 I1804V probably benign Het
Dym T A 18: 75,286,683 Y642N probably damaging Het
Efr3b A T 12: 4,000,886 D26E probably damaging Het
Emilin1 A T 5: 30,917,696 K427M possibly damaging Het
Fam187b T C 7: 30,977,234 L56S probably benign Het
Fbxo18 C T 2: 11,755,658 V694I probably benign Het
Fgd2 C T 17: 29,379,023 T644I probably benign Het
G6pc T G 11: 101,374,707 probably null Het
Gli2 A G 1: 118,836,687 S1245P probably benign Het
Gm10696 T C 3: 94,176,120 D128G probably benign Het
Gpr137b T C 13: 13,359,406 Y355C Het
Ighv1-84 T C 12: 115,980,904 D50G probably benign Het
Impdh1 C A 6: 29,216,215 probably benign Het
Irf4 A T 13: 30,761,450 D393V possibly damaging Het
Kalrn A G 16: 34,360,935 L111P probably damaging Het
Lrch3 T C 16: 32,981,853 V58A possibly damaging Het
Lrif1 C T 3: 106,732,781 T394I probably damaging Het
Map4k1 A G 7: 28,994,073 T434A probably benign Het
Mcur1 G A 13: 43,541,717 T327M probably damaging Het
Mettl7b A T 10: 128,960,607 M111K possibly damaging Het
Myo9b G T 8: 71,334,322 S716I probably benign Het
Nol10 T A 12: 17,369,771 probably benign Het
Nos3 A G 5: 24,368,843 T202A possibly damaging Het
Olfr128 T C 17: 37,924,277 V237A probably benign Het
Olfr710 A C 7: 106,944,698 M101R probably benign Het
Parp12 A T 6: 39,117,922 S80T probably benign Het
Pde1a C T 2: 79,927,742 V50I probably benign Het
Pfkl A T 10: 77,997,522 probably null Het
Phkg1 A T 5: 129,866,215 Y207N probably damaging Het
Pik3r4 A G 9: 105,658,529 T640A possibly damaging Het
Pip5k1c C A 10: 81,311,993 H411N probably damaging Het
Pla2g4e A G 2: 120,244,691 S73P probably damaging Het
Polr2b T C 5: 77,335,663 V662A probably damaging Het
Prss43 C T 9: 110,829,426 R265C possibly damaging Het
Rap1b A T 10: 117,822,841 V29D probably damaging Het
Rraga A G 4: 86,576,811 E298G probably damaging Het
Rrp8 A T 7: 105,733,574 I418N probably damaging Het
Siglecf T C 7: 43,355,606 V420A probably benign Het
Snx14 T A 9: 88,415,693 N174I probably damaging Het
Speer4e T C 5: 14,934,115 N229S probably benign Het
Teddm3 A G 16: 21,152,935 *295Q probably null Het
Tfap2c A G 2: 172,552,006 D245G possibly damaging Het
Tfap2d A G 1: 19,108,284 N191S probably benign Het
Unc80 A G 1: 66,612,268 R1591G possibly damaging Het
Vmn1r116 T C 7: 20,872,691 W146R probably damaging Het
Vps13b C G 15: 35,925,389 S3823R probably damaging Het
Wiz T A 17: 32,367,847 D163V probably damaging Het
Xylt1 G C 7: 117,381,359 A61P unknown Het
Zfp521 A C 18: 13,845,644 F571V probably damaging Het
Zfp664 T A 5: 124,886,069 C176S possibly damaging Het
Zfyve26 T C 12: 79,287,453 N264D probably benign Het
Other mutations in Cylc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Cylc2 APN 4 51228157 missense probably damaging 1.00
IGL01669:Cylc2 APN 4 51228360 missense probably benign 0.01
IGL02662:Cylc2 APN 4 51216698 utr 5 prime probably benign
R0277:Cylc2 UTSW 4 51228477 missense unknown
R0323:Cylc2 UTSW 4 51228477 missense unknown
R0968:Cylc2 UTSW 4 51216706 start codon destroyed probably null 0.50
R1395:Cylc2 UTSW 4 51228366 missense possibly damaging 0.53
R1639:Cylc2 UTSW 4 51228310 missense probably benign 0.23
R1643:Cylc2 UTSW 4 51225173 missense probably benign 0.38
R2829:Cylc2 UTSW 4 51229798 missense unknown
R4464:Cylc2 UTSW 4 51229651 missense unknown
R4467:Cylc2 UTSW 4 51229651 missense unknown
R4496:Cylc2 UTSW 4 51229651 missense unknown
R4505:Cylc2 UTSW 4 51229651 missense unknown
R4514:Cylc2 UTSW 4 51229651 missense unknown
R4546:Cylc2 UTSW 4 51229651 missense unknown
R4546:Cylc2 UTSW 4 51229840 missense unknown
R4654:Cylc2 UTSW 4 51228279 missense probably benign 0.00
R4949:Cylc2 UTSW 4 51229804 missense unknown
R5141:Cylc2 UTSW 4 51228587 intron probably benign
R5176:Cylc2 UTSW 4 51228587 intron probably benign
R5177:Cylc2 UTSW 4 51228587 intron probably benign
R5179:Cylc2 UTSW 4 51228587 intron probably benign
R7469:Cylc2 UTSW 4 51227970 splice site probably null
R7508:Cylc2 UTSW 4 51229256 splice site probably null
R7699:Cylc2 UTSW 4 51229335 missense unknown
R8685:Cylc2 UTSW 4 51229651 missense unknown
R8951:Cylc2 UTSW 4 51229469 missense unknown
Predicted Primers PCR Primer
(F):5'- TCAGCCACAGAATCTGGAGG -3'
(R):5'- TTGAACCAAGACCTACTTCTCCTAC -3'

Sequencing Primer
(F):5'- ATCTGGAGGTGAAAAGGCTGGTTC -3'
(R):5'- ACCAAGACCTACTTCTCCTACTTTGC -3'
Posted On 2021-03-08