Incidental Mutation 'R8686:Alpl'
ID 662029
Institutional Source Beutler Lab
Gene Symbol Alpl
Ensembl Gene ENSMUSG00000028766
Gene Name alkaline phosphatase, liver/bone/kidney
Synonyms TNSALP, TNAP, Akp-2, Akp2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8686 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 137741733-137796384 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 137743801 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 341 (H341Q)
Ref Sequence ENSEMBL: ENSMUSP00000030551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030551]
AlphaFold P09242
Predicted Effect probably damaging
Transcript: ENSMUST00000030551
AA Change: H341Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030551
Gene: ENSMUSG00000028766
AA Change: H341Q

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
alkPPc 52 491 4.69e-285 SMART
low complexity region 500 520 N/A INTRINSIC
Meta Mutation Damage Score 0.9632 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: This gene encodes a preproprotein that is proteolytically cleaved to yield a signal peptide and a proproptein that is subsequently processed to generate the active mature peptide. The encoded protein is a membrane-bound glycosylated enzyme that catalyzes the hydrolysis of phosphate esters at alkaline pH. The mature peptide maintains the ratio of inorganic phosphate to inorganic pyrophosphate required for bone mineralization. Mice that lack this enzyme show symptoms of osteomalacia, softening of the bones. In humans, mutations in this gene are associated with hypophosphatasia, an inherited metabolic bone disease in which deficiency of this enzyme inhibits bone mineralization leading to skeletal defects. Mutations in the mouse gene mirror the symptoms of human hypophosphatasia. A pseudogene of this gene is present on chromosome X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Males hemizygous for a null mutation exhibit reduced body size, shortened hindlimbs and tail, osteomalacia, and markedly reduced plasma phosphate levels due to impaired kidney reabsorption. Female heterozygotes exhibit milder symptoms. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik C T 9: 103,259,428 A525T probably benign Het
Adam25 A G 8: 40,755,484 T596A probably benign Het
Adamts6 A G 13: 104,313,699 I303V probably damaging Het
Cachd1 G A 4: 100,988,128 R939H probably damaging Het
Ccdc114 A G 7: 45,947,692 T456A probably benign Het
Cd22 G A 7: 30,870,069 R541C probably benign Het
Cenpf A T 1: 189,659,604 M660K probably benign Het
Cmya5 A T 13: 93,095,380 S1067T possibly damaging Het
Col5a2 C T 1: 45,421,987 G250D probably damaging Het
Cylc2 C T 4: 51,229,651 T331M unknown Het
Dgka A G 10: 128,733,093 M201T probably benign Het
Dnajc13 T C 9: 104,170,805 I1804V probably benign Het
Dym T A 18: 75,286,683 Y642N probably damaging Het
Efr3b A T 12: 4,000,886 D26E probably damaging Het
Emilin1 A T 5: 30,917,696 K427M possibly damaging Het
Fam187b T C 7: 30,977,234 L56S probably benign Het
Fbxo18 C T 2: 11,755,658 V694I probably benign Het
Fgd2 C T 17: 29,379,023 T644I probably benign Het
G6pc T G 11: 101,374,707 probably null Het
Gli2 A G 1: 118,836,687 S1245P probably benign Het
Gm10696 T C 3: 94,176,120 D128G probably benign Het
Gpr137b T C 13: 13,359,406 Y355C Het
Ighv1-84 T C 12: 115,980,904 D50G probably benign Het
Impdh1 C A 6: 29,216,215 probably benign Het
Irf4 A T 13: 30,761,450 D393V possibly damaging Het
Kalrn A G 16: 34,360,935 L111P probably damaging Het
Lrch3 T C 16: 32,981,853 V58A possibly damaging Het
Lrif1 C T 3: 106,732,781 T394I probably damaging Het
Map4k1 A G 7: 28,994,073 T434A probably benign Het
Mcur1 G A 13: 43,541,717 T327M probably damaging Het
Mettl7b A T 10: 128,960,607 M111K possibly damaging Het
Myo9b G T 8: 71,334,322 S716I probably benign Het
Nol10 T A 12: 17,369,771 probably benign Het
Nos3 A G 5: 24,368,843 T202A possibly damaging Het
Olfr128 T C 17: 37,924,277 V237A probably benign Het
Olfr710 A C 7: 106,944,698 M101R probably benign Het
Parp12 A T 6: 39,117,922 S80T probably benign Het
Pde1a C T 2: 79,927,742 V50I probably benign Het
Pfkl A T 10: 77,997,522 probably null Het
Phkg1 A T 5: 129,866,215 Y207N probably damaging Het
Pik3r4 A G 9: 105,658,529 T640A possibly damaging Het
Pip5k1c C A 10: 81,311,993 H411N probably damaging Het
Pla2g4e A G 2: 120,244,691 S73P probably damaging Het
Polr2b T C 5: 77,335,663 V662A probably damaging Het
Prss43 C T 9: 110,829,426 R265C possibly damaging Het
Rap1b A T 10: 117,822,841 V29D probably damaging Het
Rraga A G 4: 86,576,811 E298G probably damaging Het
Rrp8 A T 7: 105,733,574 I418N probably damaging Het
Siglecf T C 7: 43,355,606 V420A probably benign Het
Snx14 T A 9: 88,415,693 N174I probably damaging Het
Speer4e T C 5: 14,934,115 N229S probably benign Het
Teddm3 A G 16: 21,152,935 *295Q probably null Het
Tfap2c A G 2: 172,552,006 D245G possibly damaging Het
Tfap2d A G 1: 19,108,284 N191S probably benign Het
Unc80 A G 1: 66,612,268 R1591G possibly damaging Het
Vmn1r116 T C 7: 20,872,691 W146R probably damaging Het
Vps13b C G 15: 35,925,389 S3823R probably damaging Het
Wiz T A 17: 32,367,847 D163V probably damaging Het
Xylt1 G C 7: 117,381,359 A61P unknown Het
Zfp521 A C 18: 13,845,644 F571V probably damaging Het
Zfp664 T A 5: 124,886,069 C176S possibly damaging Het
Zfyve26 T C 12: 79,287,453 N264D probably benign Het
Other mutations in Alpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Alpl APN 4 137743313 splice site probably benign
IGL02164:Alpl APN 4 137753979 missense probably damaging 1.00
IGL02379:Alpl APN 4 137742558 missense probably damaging 1.00
IGL02632:Alpl APN 4 137753906 missense probably damaging 0.98
IGL02926:Alpl APN 4 137742634 missense probably damaging 1.00
R0492:Alpl UTSW 4 137749576 splice site probably null
R1157:Alpl UTSW 4 137754020 missense probably damaging 1.00
R2013:Alpl UTSW 4 137755147 missense probably benign 0.00
R2067:Alpl UTSW 4 137749545 unclassified probably benign
R4412:Alpl UTSW 4 137758628 missense possibly damaging 0.84
R4440:Alpl UTSW 4 137747813 missense probably damaging 1.00
R5275:Alpl UTSW 4 137749608 missense probably benign 0.00
R5295:Alpl UTSW 4 137749608 missense probably benign 0.00
R5529:Alpl UTSW 4 137746422 missense probably damaging 0.99
R6706:Alpl UTSW 4 137746429 missense probably benign 0.00
R7291:Alpl UTSW 4 137752698 missense probably damaging 1.00
R7693:Alpl UTSW 4 137743809 missense probably damaging 1.00
R7694:Alpl UTSW 4 137743809 missense probably damaging 1.00
R8247:Alpl UTSW 4 137746453 missense probably damaging 1.00
R8725:Alpl UTSW 4 137747816 missense probably benign
R8727:Alpl UTSW 4 137747816 missense probably benign
X0017:Alpl UTSW 4 137746467 missense probably damaging 1.00
Z1176:Alpl UTSW 4 137754010 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGCTGCTTCGCTGTATC -3'
(R):5'- ACTTGGCCATGAGATGCCTG -3'

Sequencing Primer
(F):5'- TGTATCCCAGGGACAGGCTACTC -3'
(R):5'- CCATGAGATGCCTGAGGTAGACC -3'
Posted On 2021-03-08