Incidental Mutation 'R8686:Emilin1'
ID 662032
Institutional Source Beutler Lab
Gene Symbol Emilin1
Ensembl Gene ENSMUSG00000029163
Gene Name elastin microfibril interfacer 1
Synonyms gp115, 5830419M17Rik, EMILIN-1
MMRRC Submission 068541-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.164) question?
Stock # R8686 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 31070746-31078621 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 31075040 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Methionine at position 427 (K427M)
Ref Sequence ENSEMBL: ENSMUSP00000031055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031053] [ENSMUST00000031055] [ENSMUST00000201571] [ENSMUST00000201621] [ENSMUST00000202752]
AlphaFold Q99K41
Predicted Effect probably benign
Transcript: ENSMUST00000031053
SMART Domains Protein: ENSMUSP00000031053
Gene: ENSMUSG00000029162

DomainStartEndE-ValueType
Pfam:PfkB 3 293 5.7e-36 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000031055
AA Change: K427M

PolyPhen 2 Score 0.846 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000031055
Gene: ENSMUSG00000029163
AA Change: K427M

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:EMI 57 128 1.2e-19 PFAM
low complexity region 141 155 N/A INTRINSIC
low complexity region 157 171 N/A INTRINSIC
coiled coil region 174 210 N/A INTRINSIC
coiled coil region 237 263 N/A INTRINSIC
coiled coil region 310 342 N/A INTRINSIC
low complexity region 389 400 N/A INTRINSIC
internal_repeat_1 422 474 9.62e-7 PROSPERO
coiled coil region 527 563 N/A INTRINSIC
low complexity region 606 627 N/A INTRINSIC
low complexity region 629 639 N/A INTRINSIC
internal_repeat_1 704 758 9.62e-7 PROSPERO
low complexity region 780 810 N/A INTRINSIC
Pfam:Collagen 813 870 3.3e-10 PFAM
Pfam:C1q 873 1008 1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201571
SMART Domains Protein: ENSMUSP00000144226
Gene: ENSMUSG00000029162

DomainStartEndE-ValueType
Pfam:PfkB 3 70 2.4e-5 PFAM
Pfam:PfkB 65 249 4.5e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201621
SMART Domains Protein: ENSMUSP00000144050
Gene: ENSMUSG00000029162

DomainStartEndE-ValueType
Pfam:PfkB 3 294 1.5e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202752
SMART Domains Protein: ENSMUSP00000143850
Gene: ENSMUSG00000029162

DomainStartEndE-ValueType
Pfam:PfkB 3 243 5.8e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular matrix glycoprotein that is characterized by an N-terminal microfibril interface domain, a coiled-coiled alpha-helical domain, a collagenous domain and a C-terminal globular C1q domain. The encoded protein associates with elastic fibers at the interface between elastin and microfibrils and may play a role in the development of elastic tissues including large blood vessels, dermis, heart and lung. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene display no goss abnormalities. However, histological defects occur in the skin and aorta relating to elastin fiber abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 A G 8: 41,208,521 (GRCm39) T596A probably benign Het
Adamts6 A G 13: 104,450,207 (GRCm39) I303V probably damaging Het
Alpl A T 4: 137,471,112 (GRCm39) H341Q probably damaging Het
Cachd1 G A 4: 100,845,325 (GRCm39) R939H probably damaging Het
Cd22 G A 7: 30,569,494 (GRCm39) R541C probably benign Het
Cenpf A T 1: 189,391,801 (GRCm39) M660K probably benign Het
Cmya5 A T 13: 93,231,888 (GRCm39) S1067T possibly damaging Het
Col5a2 C T 1: 45,461,147 (GRCm39) G250D probably damaging Het
Cylc2 C T 4: 51,229,651 (GRCm39) T331M unknown Het
Dgka A G 10: 128,568,962 (GRCm39) M201T probably benign Het
Dnajc13 T C 9: 104,048,004 (GRCm39) I1804V probably benign Het
Dym T A 18: 75,419,754 (GRCm39) Y642N probably damaging Het
Efr3b A T 12: 4,050,886 (GRCm39) D26E probably damaging Het
Fam187b T C 7: 30,676,659 (GRCm39) L56S probably benign Het
Fbh1 C T 2: 11,760,469 (GRCm39) V694I probably benign Het
Fgd2 C T 17: 29,597,997 (GRCm39) T644I probably benign Het
G6pc1 T G 11: 101,265,533 (GRCm39) probably null Het
Gli2 A G 1: 118,764,417 (GRCm39) S1245P probably benign Het
Gpr137b T C 13: 13,533,991 (GRCm39) Y355C Het
Ighv1-84 T C 12: 115,944,524 (GRCm39) D50G probably benign Het
Impdh1 C A 6: 29,216,214 (GRCm39) probably benign Het
Inhca C T 9: 103,136,627 (GRCm39) A525T probably benign Het
Irf4 A T 13: 30,945,433 (GRCm39) D393V possibly damaging Het
Kalrn A G 16: 34,181,305 (GRCm39) L111P probably damaging Het
Lrch3 T C 16: 32,802,223 (GRCm39) V58A possibly damaging Het
Lrif1 C T 3: 106,640,097 (GRCm39) T394I probably damaging Het
Map4k1 A G 7: 28,693,498 (GRCm39) T434A probably benign Het
Mcur1 G A 13: 43,695,193 (GRCm39) T327M probably damaging Het
Myo9b G T 8: 71,786,966 (GRCm39) S716I probably benign Het
Nol10 T A 12: 17,419,772 (GRCm39) probably benign Het
Nos3 A G 5: 24,573,841 (GRCm39) T202A possibly damaging Het
Odad1 A G 7: 45,597,116 (GRCm39) T456A probably benign Het
Or14j7 T C 17: 38,235,168 (GRCm39) V237A probably benign Het
Or2d4 A C 7: 106,543,905 (GRCm39) M101R probably benign Het
Parp12 A T 6: 39,094,856 (GRCm39) S80T probably benign Het
Pde1a C T 2: 79,758,086 (GRCm39) V50I probably benign Het
Pfkl A T 10: 77,833,356 (GRCm39) probably null Het
Phkg1 A T 5: 129,895,056 (GRCm39) Y207N probably damaging Het
Pik3r4 A G 9: 105,535,728 (GRCm39) T640A possibly damaging Het
Pip5k1c C A 10: 81,147,827 (GRCm39) H411N probably damaging Het
Pla2g4e A G 2: 120,075,172 (GRCm39) S73P probably damaging Het
Polr2b T C 5: 77,483,510 (GRCm39) V662A probably damaging Het
Prss43 C T 9: 110,658,494 (GRCm39) R265C possibly damaging Het
Rap1b A T 10: 117,658,746 (GRCm39) V29D probably damaging Het
Rraga A G 4: 86,495,048 (GRCm39) E298G probably damaging Het
Rrp8 A T 7: 105,382,781 (GRCm39) I418N probably damaging Het
Siglecf T C 7: 43,005,030 (GRCm39) V420A probably benign Het
Snx14 T A 9: 88,297,746 (GRCm39) N174I probably damaging Het
Speer4e1 T C 5: 14,984,129 (GRCm39) N229S probably benign Het
Spopfm2 T C 3: 94,083,427 (GRCm39) D128G probably benign Het
Teddm3 A G 16: 20,971,685 (GRCm39) *295Q probably null Het
Tfap2c A G 2: 172,393,926 (GRCm39) D245G possibly damaging Het
Tfap2d A G 1: 19,178,508 (GRCm39) N191S probably benign Het
Tmt1b A T 10: 128,796,476 (GRCm39) M111K possibly damaging Het
Unc80 A G 1: 66,651,427 (GRCm39) R1591G possibly damaging Het
Vmn1r116 T C 7: 20,606,616 (GRCm39) W146R probably damaging Het
Vps13b C G 15: 35,925,535 (GRCm39) S3823R probably damaging Het
Wiz T A 17: 32,586,821 (GRCm39) D163V probably damaging Het
Xylt1 G C 7: 116,980,594 (GRCm39) A61P unknown Het
Zfp521 A C 18: 13,978,701 (GRCm39) F571V probably damaging Het
Zfp664 T A 5: 124,963,133 (GRCm39) C176S possibly damaging Het
Zfyve26 T C 12: 79,334,227 (GRCm39) N264D probably benign Het
Other mutations in Emilin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Emilin1 APN 5 31,071,246 (GRCm39) missense probably damaging 0.97
IGL01100:Emilin1 APN 5 31,075,748 (GRCm39) missense probably benign
IGL02150:Emilin1 APN 5 31,077,517 (GRCm39) missense possibly damaging 0.85
IGL02416:Emilin1 APN 5 31,075,132 (GRCm39) missense possibly damaging 0.92
IGL02973:Emilin1 APN 5 31,078,007 (GRCm39) missense probably damaging 0.97
R0142:Emilin1 UTSW 5 31,071,264 (GRCm39) missense probably benign 0.00
R0419:Emilin1 UTSW 5 31,072,366 (GRCm39) missense probably damaging 1.00
R1580:Emilin1 UTSW 5 31,074,764 (GRCm39) missense probably damaging 0.99
R1679:Emilin1 UTSW 5 31,077,543 (GRCm39) missense probably benign 0.00
R1802:Emilin1 UTSW 5 31,075,082 (GRCm39) missense possibly damaging 0.68
R1803:Emilin1 UTSW 5 31,075,082 (GRCm39) missense possibly damaging 0.68
R1864:Emilin1 UTSW 5 31,075,934 (GRCm39) missense probably damaging 1.00
R1958:Emilin1 UTSW 5 31,075,160 (GRCm39) missense probably benign 0.03
R2061:Emilin1 UTSW 5 31,075,082 (GRCm39) missense possibly damaging 0.68
R2100:Emilin1 UTSW 5 31,075,241 (GRCm39) missense probably benign 0.01
R2201:Emilin1 UTSW 5 31,073,036 (GRCm39) missense probably benign 0.33
R2206:Emilin1 UTSW 5 31,075,082 (GRCm39) missense possibly damaging 0.68
R2274:Emilin1 UTSW 5 31,075,082 (GRCm39) missense possibly damaging 0.68
R2275:Emilin1 UTSW 5 31,075,082 (GRCm39) missense possibly damaging 0.68
R2285:Emilin1 UTSW 5 31,075,544 (GRCm39) missense probably damaging 1.00
R2851:Emilin1 UTSW 5 31,074,509 (GRCm39) missense probably benign 0.38
R3706:Emilin1 UTSW 5 31,075,166 (GRCm39) missense possibly damaging 0.47
R4205:Emilin1 UTSW 5 31,077,243 (GRCm39) unclassified probably benign
R4865:Emilin1 UTSW 5 31,075,128 (GRCm39) missense possibly damaging 0.93
R4878:Emilin1 UTSW 5 31,074,410 (GRCm39) missense probably benign
R4981:Emilin1 UTSW 5 31,076,695 (GRCm39) missense probably benign
R5113:Emilin1 UTSW 5 31,077,964 (GRCm39) missense possibly damaging 0.73
R5232:Emilin1 UTSW 5 31,074,323 (GRCm39) missense probably benign 0.00
R5853:Emilin1 UTSW 5 31,075,966 (GRCm39) missense probably damaging 0.98
R6358:Emilin1 UTSW 5 31,075,562 (GRCm39) missense probably damaging 0.98
R6807:Emilin1 UTSW 5 31,072,871 (GRCm39) missense probably benign 0.10
R6932:Emilin1 UTSW 5 31,074,421 (GRCm39) missense probably damaging 1.00
R6955:Emilin1 UTSW 5 31,075,253 (GRCm39) missense probably damaging 1.00
R7047:Emilin1 UTSW 5 31,074,422 (GRCm39) missense probably benign 0.05
R7278:Emilin1 UTSW 5 31,078,004 (GRCm39) missense probably benign 0.32
R7305:Emilin1 UTSW 5 31,074,433 (GRCm39) nonsense probably null
R8087:Emilin1 UTSW 5 31,074,444 (GRCm39) missense probably damaging 1.00
R8208:Emilin1 UTSW 5 31,074,860 (GRCm39) missense probably damaging 1.00
R8516:Emilin1 UTSW 5 31,074,515 (GRCm39) missense probably damaging 1.00
R9224:Emilin1 UTSW 5 31,074,823 (GRCm39) missense probably damaging 1.00
R9526:Emilin1 UTSW 5 31,075,484 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGCTAGATGTAGTGACTGGC -3'
(R):5'- CAAGGCACTGAGGATCTCATTGAC -3'

Sequencing Primer
(F):5'- CTGGCTCACTGACAGTGCTAAG -3'
(R):5'- TGAGGATCTCATTGACCCGAGAATC -3'
Posted On 2021-03-08