Incidental Mutation 'R8686:Zfp664'
ID662034
Institutional Source Beutler Lab
Gene Symbol Zfp664
Ensembl Gene ENSMUSG00000079215
Gene Namezinc finger protein 664
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8686 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location124862691-124902693 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 124886069 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 176 (C176S)
Ref Sequence ENSEMBL: ENSMUSP00000107048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111417]
Predicted Effect possibly damaging
Transcript: ENSMUST00000111417
AA Change: C176S

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000107048
Gene: ENSMUSG00000079215
AA Change: C176S

DomainStartEndE-ValueType
ZnF_C2H2 3 25 2.57e-3 SMART
ZnF_C2H2 31 53 7.55e-1 SMART
ZnF_C2H2 59 81 5.99e-4 SMART
ZnF_C2H2 87 109 3.21e-4 SMART
ZnF_C2H2 115 137 4.54e-4 SMART
ZnF_C2H2 143 165 4.79e-3 SMART
ZnF_C2H2 171 193 8.34e-3 SMART
ZnF_C2H2 199 221 6.23e-2 SMART
ZnF_C2H2 227 249 7.9e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik C T 9: 103,259,428 A525T probably benign Het
Adam25 A G 8: 40,755,484 T596A probably benign Het
Adamts6 A G 13: 104,313,699 I303V probably damaging Het
Alpl A T 4: 137,743,801 H341Q probably damaging Het
Cachd1 G A 4: 100,988,128 R939H probably damaging Het
Ccdc114 A G 7: 45,947,692 T456A probably benign Het
Cd22 G A 7: 30,870,069 R541C probably benign Het
Cenpf A T 1: 189,659,604 M660K probably benign Het
Cmya5 A T 13: 93,095,380 S1067T possibly damaging Het
Col5a2 C T 1: 45,421,987 G250D probably damaging Het
Cylc2 C T 4: 51,229,651 T331M unknown Het
Dgka A G 10: 128,733,093 M201T probably benign Het
Dnajc13 T C 9: 104,170,805 I1804V probably benign Het
Dym T A 18: 75,286,683 Y642N probably damaging Het
Efr3b A T 12: 4,000,886 D26E probably damaging Het
Emilin1 A T 5: 30,917,696 K427M possibly damaging Het
Fam187b T C 7: 30,977,234 L56S probably benign Het
Fbxo18 C T 2: 11,755,658 V694I probably benign Het
Fgd2 C T 17: 29,379,023 T644I probably benign Het
G6pc T G 11: 101,374,707 probably null Het
Gli2 A G 1: 118,836,687 S1245P probably benign Het
Gm10696 T C 3: 94,176,120 D128G probably benign Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Ighv1-84 T C 12: 115,980,904 D50G probably benign Het
Impdh1 C A 6: 29,216,215 probably benign Het
Irf4 A T 13: 30,761,450 D393V possibly damaging Het
Kalrn A G 16: 34,360,935 L111P probably damaging Het
Lrch3 T C 16: 32,981,853 V58A possibly damaging Het
Lrif1 C T 3: 106,732,781 T394I probably damaging Het
Map4k1 A G 7: 28,994,073 T434A probably benign Het
Mcur1 G A 13: 43,541,717 T327M probably damaging Het
Mettl7b A T 10: 128,960,607 M111K possibly damaging Het
Myo9b G T 8: 71,334,322 S716I probably benign Het
Nol10 T A 12: 17,369,771 probably benign Het
Nos3 A G 5: 24,368,843 T202A possibly damaging Het
Olfr128 T C 17: 37,924,277 V237A probably benign Het
Olfr710 A C 7: 106,944,698 M101R probably benign Het
Parp12 A T 6: 39,117,922 S80T probably benign Het
Pde1a C T 2: 79,927,742 V50I probably benign Het
Pfkl A T 10: 77,997,522 probably null Het
Phkg1 A T 5: 129,866,215 Y207N probably damaging Het
Pik3r4 A G 9: 105,658,529 T640A possibly damaging Het
Pip5k1c C A 10: 81,311,993 H411N probably damaging Het
Pla2g4e A G 2: 120,244,691 S73P probably damaging Het
Polr2b T C 5: 77,335,663 V662A probably damaging Het
Prss43 C T 9: 110,829,426 R265C possibly damaging Het
Rap1b A T 10: 117,822,841 V29D probably damaging Het
Rraga A G 4: 86,576,811 E298G probably damaging Het
Rrp8 A T 7: 105,733,574 I418N probably damaging Het
Siglecf T C 7: 43,355,606 V420A probably benign Het
Snx14 T A 9: 88,415,693 N174I probably damaging Het
Speer4e T C 5: 14,934,115 N229S probably benign Het
Teddm3 A G 16: 21,152,935 *295Q probably null Het
Tfap2c A G 2: 172,552,006 D245G possibly damaging Het
Tfap2d A G 1: 19,108,284 N191S probably benign Het
Unc80 A G 1: 66,612,268 R1591G possibly damaging Het
Vmn1r116 T C 7: 20,872,691 W146R probably damaging Het
Vps13b C G 15: 35,925,389 S3823R probably damaging Het
Wiz T A 17: 32,367,847 D163V probably damaging Het
Xylt1 G C 7: 117,381,359 A61P unknown Het
Zfp521 A C 18: 13,845,644 F571V probably damaging Het
Zfyve26 T C 12: 79,287,453 N264D probably benign Het
Other mutations in Zfp664
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01556:Zfp664 APN 5 124886188 nonsense probably null
IGL02683:Zfp664 APN 5 124886322 missense probably benign 0.03
R0394:Zfp664 UTSW 5 124886065 nonsense probably null
R0629:Zfp664 UTSW 5 124885595 missense probably damaging 0.99
R1400:Zfp664 UTSW 5 124886153 missense unknown
R6052:Zfp664 UTSW 5 124886186 missense unknown
R6058:Zfp664 UTSW 5 124885978 nonsense probably null
R6529:Zfp664 UTSW 5 124886288 missense probably damaging 1.00
R7031:Zfp664 UTSW 5 124886006 missense probably benign 0.06
R7752:Zfp664 UTSW 5 124885775 nonsense probably null
R7901:Zfp664 UTSW 5 124885775 nonsense probably null
R8434:Zfp664 UTSW 5 124885763 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TGGAGCTCCCACCTTCAAATC -3'
(R):5'- TTCCTAGTGGCACTTACGGG -3'

Sequencing Primer
(F):5'- CACATGAGAGTCCACACTGGG -3'
(R):5'- TACTCTCTGATGGATGCAAAGGC -3'
Posted On2021-03-08