Incidental Mutation 'R8686:Phkg1'
ID 662035
Institutional Source Beutler Lab
Gene Symbol Phkg1
Ensembl Gene ENSMUSG00000025537
Gene Name phosphorylase kinase gamma 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock # R8686 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 129863421-129898549 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 129866215 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 207 (Y207N)
Ref Sequence ENSEMBL: ENSMUSP00000026617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026617] [ENSMUST00000137357] [ENSMUST00000140667] [ENSMUST00000154932] [ENSMUST00000171300]
AlphaFold P07934
Predicted Effect probably damaging
Transcript: ENSMUST00000026617
AA Change: Y207N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026617
Gene: ENSMUSG00000025537
AA Change: Y207N

DomainStartEndE-ValueType
S_TKc 20 288 3.79e-106 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137357
SMART Domains Protein: ENSMUSP00000144155
Gene: ENSMUSG00000025538

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:FGE-sulfatase 25 136 6.2e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140667
SMART Domains Protein: ENSMUSP00000117510
Gene: ENSMUSG00000025537

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 20 143 4.1e-9 PFAM
Pfam:Pkinase 20 144 3.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154932
SMART Domains Protein: ENSMUSP00000122040
Gene: ENSMUSG00000025537

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 95 3.6e-13 PFAM
Pfam:Pkinase 1 100 7.3e-32 PFAM
Pfam:Kdo 3 77 8.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171300
SMART Domains Protein: ENSMUSP00000126036
Gene: ENSMUSG00000025538

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:FGE-sulfatase 34 299 3.9e-88 PFAM
Meta Mutation Damage Score 0.8718 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Ser/Thr protein kinase family and encodes a protein with one protein kinase domain and two calmodulin-binding domains. This protein is the catalytic member of a 16 subunit protein kinase complex which contains equimolar ratios of 4 subunit types. The complex is a crucial glycogenolytic regulatory enzyme. This gene has two pseudogenes at chromosome 7q11.21 and one at chromosome 11p11.12. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik C T 9: 103,259,428 A525T probably benign Het
Adam25 A G 8: 40,755,484 T596A probably benign Het
Adamts6 A G 13: 104,313,699 I303V probably damaging Het
Alpl A T 4: 137,743,801 H341Q probably damaging Het
Cachd1 G A 4: 100,988,128 R939H probably damaging Het
Ccdc114 A G 7: 45,947,692 T456A probably benign Het
Cd22 G A 7: 30,870,069 R541C probably benign Het
Cenpf A T 1: 189,659,604 M660K probably benign Het
Cmya5 A T 13: 93,095,380 S1067T possibly damaging Het
Col5a2 C T 1: 45,421,987 G250D probably damaging Het
Cylc2 C T 4: 51,229,651 T331M unknown Het
Dgka A G 10: 128,733,093 M201T probably benign Het
Dnajc13 T C 9: 104,170,805 I1804V probably benign Het
Dym T A 18: 75,286,683 Y642N probably damaging Het
Efr3b A T 12: 4,000,886 D26E probably damaging Het
Emilin1 A T 5: 30,917,696 K427M possibly damaging Het
Fam187b T C 7: 30,977,234 L56S probably benign Het
Fbxo18 C T 2: 11,755,658 V694I probably benign Het
Fgd2 C T 17: 29,379,023 T644I probably benign Het
G6pc T G 11: 101,374,707 probably null Het
Gli2 A G 1: 118,836,687 S1245P probably benign Het
Gm10696 T C 3: 94,176,120 D128G probably benign Het
Gpr137b T C 13: 13,359,406 Y355C Het
Ighv1-84 T C 12: 115,980,904 D50G probably benign Het
Impdh1 C A 6: 29,216,215 probably benign Het
Irf4 A T 13: 30,761,450 D393V possibly damaging Het
Kalrn A G 16: 34,360,935 L111P probably damaging Het
Lrch3 T C 16: 32,981,853 V58A possibly damaging Het
Lrif1 C T 3: 106,732,781 T394I probably damaging Het
Map4k1 A G 7: 28,994,073 T434A probably benign Het
Mcur1 G A 13: 43,541,717 T327M probably damaging Het
Mettl7b A T 10: 128,960,607 M111K possibly damaging Het
Myo9b G T 8: 71,334,322 S716I probably benign Het
Nol10 T A 12: 17,369,771 probably benign Het
Nos3 A G 5: 24,368,843 T202A possibly damaging Het
Olfr128 T C 17: 37,924,277 V237A probably benign Het
Olfr710 A C 7: 106,944,698 M101R probably benign Het
Parp12 A T 6: 39,117,922 S80T probably benign Het
Pde1a C T 2: 79,927,742 V50I probably benign Het
Pfkl A T 10: 77,997,522 probably null Het
Pik3r4 A G 9: 105,658,529 T640A possibly damaging Het
Pip5k1c C A 10: 81,311,993 H411N probably damaging Het
Pla2g4e A G 2: 120,244,691 S73P probably damaging Het
Polr2b T C 5: 77,335,663 V662A probably damaging Het
Prss43 C T 9: 110,829,426 R265C possibly damaging Het
Rap1b A T 10: 117,822,841 V29D probably damaging Het
Rraga A G 4: 86,576,811 E298G probably damaging Het
Rrp8 A T 7: 105,733,574 I418N probably damaging Het
Siglecf T C 7: 43,355,606 V420A probably benign Het
Snx14 T A 9: 88,415,693 N174I probably damaging Het
Speer4e T C 5: 14,934,115 N229S probably benign Het
Teddm3 A G 16: 21,152,935 *295Q probably null Het
Tfap2c A G 2: 172,552,006 D245G possibly damaging Het
Tfap2d A G 1: 19,108,284 N191S probably benign Het
Unc80 A G 1: 66,612,268 R1591G possibly damaging Het
Vmn1r116 T C 7: 20,872,691 W146R probably damaging Het
Vps13b C G 15: 35,925,389 S3823R probably damaging Het
Wiz T A 17: 32,367,847 D163V probably damaging Het
Xylt1 G C 7: 117,381,359 A61P unknown Het
Zfp521 A C 18: 13,845,644 F571V probably damaging Het
Zfp664 T A 5: 124,886,069 C176S possibly damaging Het
Zfyve26 T C 12: 79,287,453 N264D probably benign Het
Other mutations in Phkg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Phkg1 APN 5 129865073 nonsense probably null
IGL01116:Phkg1 APN 5 129864972 splice site probably null
IGL01713:Phkg1 APN 5 129866873 missense probably benign 0.01
IGL02246:Phkg1 APN 5 129864638 missense probably damaging 0.97
IGL02803:Phkg1 APN 5 129866054 missense possibly damaging 0.95
IGL02954:Phkg1 APN 5 129866069 missense probably damaging 1.00
PIT4403001:Phkg1 UTSW 5 129865931 missense probably benign 0.02
R0041:Phkg1 UTSW 5 129874262 missense probably benign
R0140:Phkg1 UTSW 5 129864608 missense probably benign 0.01
R0321:Phkg1 UTSW 5 129869524 start codon destroyed probably null 1.00
R0646:Phkg1 UTSW 5 129864553 splice site probably null
R1142:Phkg1 UTSW 5 129873232 missense possibly damaging 0.92
R1446:Phkg1 UTSW 5 129873214 critical splice donor site probably null
R2350:Phkg1 UTSW 5 129864532 missense probably damaging 1.00
R2896:Phkg1 UTSW 5 129864630 missense possibly damaging 0.46
R4773:Phkg1 UTSW 5 129873273 splice site probably null
R7236:Phkg1 UTSW 5 129866961 missense probably damaging 1.00
R7499:Phkg1 UTSW 5 129873268 nonsense probably null
R7658:Phkg1 UTSW 5 129865923 missense probably damaging 1.00
R7719:Phkg1 UTSW 5 129873858 start gained probably benign
R8827:Phkg1 UTSW 5 129865053 missense probably benign
R9090:Phkg1 UTSW 5 129865022 missense probably benign 0.04
R9271:Phkg1 UTSW 5 129865022 missense probably benign 0.04
R9627:Phkg1 UTSW 5 129864535 nonsense probably null
Z1177:Phkg1 UTSW 5 129866255 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTGCTTCCGGTGCCAGAAAG -3'
(R):5'- TGAGTGTAAAATAGGAGAGCCCTC -3'

Sequencing Primer
(F):5'- CCAGCCAGCAGAGTGTACATG -3'
(R):5'- GAGAGCCCTCCCAAGCACTG -3'
Posted On 2021-03-08