Incidental Mutation 'R8686:Impdh1'
ID 662036
Institutional Source Beutler Lab
Gene Symbol Impdh1
Ensembl Gene ENSMUSG00000003500
Gene Name inosine monophosphate dehydrogenase 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.283) question?
Stock # R8686 (G1)
Quality Score 99.0078
Status Validated
Chromosome 6
Chromosomal Location 29200434-29216364 bp(-) (GRCm38)
Type of Mutation start gained
DNA Base Change (assembly) C to A at 29216215 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125235 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078155] [ENSMUST00000159124] [ENSMUST00000160749] [ENSMUST00000160878] [ENSMUST00000162099] [ENSMUST00000162215] [ENSMUST00000162739]
AlphaFold P50096
Predicted Effect probably benign
Transcript: ENSMUST00000078155
SMART Domains Protein: ENSMUSP00000077289
Gene: ENSMUSG00000003500

DomainStartEndE-ValueType
IMPDH 28 504 6.73e-263 SMART
CBS 117 168 6.49e-10 SMART
CBS 184 232 3.37e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159124
SMART Domains Protein: ENSMUSP00000124931
Gene: ENSMUSG00000003500

DomainStartEndE-ValueType
IMPDH 28 504 6.73e-263 SMART
CBS 117 168 6.49e-10 SMART
CBS 184 232 3.37e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160749
SMART Domains Protein: ENSMUSP00000125488
Gene: ENSMUSG00000003500

DomainStartEndE-ValueType
Pfam:IMPDH 28 84 3.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160878
SMART Domains Protein: ENSMUSP00000124269
Gene: ENSMUSG00000003500

DomainStartEndE-ValueType
IMPDH 28 479 2.97e-232 SMART
CBS 92 143 6.49e-10 SMART
CBS 159 207 3.37e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162099
SMART Domains Protein: ENSMUSP00000124541
Gene: ENSMUSG00000003500

DomainStartEndE-ValueType
IMPDH 28 504 6.73e-263 SMART
CBS 117 168 6.49e-10 SMART
CBS 184 232 3.37e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162215
SMART Domains Protein: ENSMUSP00000125235
Gene: ENSMUSG00000003500

DomainStartEndE-ValueType
IMPDH 28 231 5.75e-17 SMART
CBS 161 209 3.37e-8 SMART
Predicted Effect silent
Transcript: ENSMUST00000162739
SMART Domains Protein: ENSMUSP00000125077
Gene: ENSMUSG00000003500

DomainStartEndE-ValueType
low complexity region 8 22 N/A INTRINSIC
low complexity region 32 61 N/A INTRINSIC
IMPDH 86 558 2e-256 SMART
CBS 171 222 6.49e-10 SMART
CBS 238 286 3.37e-8 SMART
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts as a homotetramer to regulate cell growth. The encoded protein is an enzyme that catalyzes the synthesis of xanthine monophosphate (XMP) from inosine-5'-monophosphate (IMP). This is the rate-limiting step in the de novo synthesis of guanine nucleotides. Defects in this gene are a cause of retinitis pigmentosa type 10 (RP10). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mic homozygous for disruptions of this gene display abnormalities in T cell proliferation. Mice homozygous for an ENU-induced mutation exhibit reduced thickness of the outer nuclear layer and total retina thickness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik C T 9: 103,259,428 A525T probably benign Het
Adam25 A G 8: 40,755,484 T596A probably benign Het
Adamts6 A G 13: 104,313,699 I303V probably damaging Het
Alpl A T 4: 137,743,801 H341Q probably damaging Het
Cachd1 G A 4: 100,988,128 R939H probably damaging Het
Ccdc114 A G 7: 45,947,692 T456A probably benign Het
Cd22 G A 7: 30,870,069 R541C probably benign Het
Cenpf A T 1: 189,659,604 M660K probably benign Het
Cmya5 A T 13: 93,095,380 S1067T possibly damaging Het
Col5a2 C T 1: 45,421,987 G250D probably damaging Het
Cylc2 C T 4: 51,229,651 T331M unknown Het
Dgka A G 10: 128,733,093 M201T probably benign Het
Dnajc13 T C 9: 104,170,805 I1804V probably benign Het
Dym T A 18: 75,286,683 Y642N probably damaging Het
Efr3b A T 12: 4,000,886 D26E probably damaging Het
Emilin1 A T 5: 30,917,696 K427M possibly damaging Het
Fam187b T C 7: 30,977,234 L56S probably benign Het
Fbxo18 C T 2: 11,755,658 V694I probably benign Het
Fgd2 C T 17: 29,379,023 T644I probably benign Het
G6pc T G 11: 101,374,707 probably null Het
Gli2 A G 1: 118,836,687 S1245P probably benign Het
Gm10696 T C 3: 94,176,120 D128G probably benign Het
Gpr137b T C 13: 13,359,406 Y355C Het
Ighv1-84 T C 12: 115,980,904 D50G probably benign Het
Irf4 A T 13: 30,761,450 D393V possibly damaging Het
Kalrn A G 16: 34,360,935 L111P probably damaging Het
Lrch3 T C 16: 32,981,853 V58A possibly damaging Het
Lrif1 C T 3: 106,732,781 T394I probably damaging Het
Map4k1 A G 7: 28,994,073 T434A probably benign Het
Mcur1 G A 13: 43,541,717 T327M probably damaging Het
Mettl7b A T 10: 128,960,607 M111K possibly damaging Het
Myo9b G T 8: 71,334,322 S716I probably benign Het
Nol10 T A 12: 17,369,771 probably benign Het
Nos3 A G 5: 24,368,843 T202A possibly damaging Het
Olfr128 T C 17: 37,924,277 V237A probably benign Het
Olfr710 A C 7: 106,944,698 M101R probably benign Het
Parp12 A T 6: 39,117,922 S80T probably benign Het
Pde1a C T 2: 79,927,742 V50I probably benign Het
Pfkl A T 10: 77,997,522 probably null Het
Phkg1 A T 5: 129,866,215 Y207N probably damaging Het
Pik3r4 A G 9: 105,658,529 T640A possibly damaging Het
Pip5k1c C A 10: 81,311,993 H411N probably damaging Het
Pla2g4e A G 2: 120,244,691 S73P probably damaging Het
Polr2b T C 5: 77,335,663 V662A probably damaging Het
Prss43 C T 9: 110,829,426 R265C possibly damaging Het
Rap1b A T 10: 117,822,841 V29D probably damaging Het
Rraga A G 4: 86,576,811 E298G probably damaging Het
Rrp8 A T 7: 105,733,574 I418N probably damaging Het
Siglecf T C 7: 43,355,606 V420A probably benign Het
Snx14 T A 9: 88,415,693 N174I probably damaging Het
Speer4e T C 5: 14,934,115 N229S probably benign Het
Teddm3 A G 16: 21,152,935 *295Q probably null Het
Tfap2c A G 2: 172,552,006 D245G possibly damaging Het
Tfap2d A G 1: 19,108,284 N191S probably benign Het
Unc80 A G 1: 66,612,268 R1591G possibly damaging Het
Vmn1r116 T C 7: 20,872,691 W146R probably damaging Het
Vps13b C G 15: 35,925,389 S3823R probably damaging Het
Wiz T A 17: 32,367,847 D163V probably damaging Het
Xylt1 G C 7: 117,381,359 A61P unknown Het
Zfp521 A C 18: 13,845,644 F571V probably damaging Het
Zfp664 T A 5: 124,886,069 C176S possibly damaging Het
Zfyve26 T C 12: 79,287,453 N264D probably benign Het
Other mutations in Impdh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01543:Impdh1 APN 6 29203378 missense probably damaging 0.97
IGL01642:Impdh1 APN 6 29207166 missense possibly damaging 0.57
IGL02187:Impdh1 APN 6 29207087 splice site probably benign
IGL02294:Impdh1 APN 6 29205202 missense probably benign 0.19
IGL02570:Impdh1 APN 6 29203198 missense probably damaging 1.00
IGL02858:Impdh1 APN 6 29206925 nonsense probably null
IGL02874:Impdh1 APN 6 29203156 missense probably damaging 1.00
steve UTSW 6 29204632 nonsense probably null
R0089:Impdh1 UTSW 6 29206326 missense probably benign
R0855:Impdh1 UTSW 6 29206972 missense probably damaging 1.00
R1331:Impdh1 UTSW 6 29206478 missense probably damaging 0.96
R1797:Impdh1 UTSW 6 29207169 missense probably damaging 0.98
R1824:Impdh1 UTSW 6 29205088 missense probably benign 0.08
R1981:Impdh1 UTSW 6 29206451 missense possibly damaging 0.70
R2076:Impdh1 UTSW 6 29205163 missense probably damaging 0.99
R3841:Impdh1 UTSW 6 29202769 missense probably damaging 0.98
R4020:Impdh1 UTSW 6 29202694 missense probably benign 0.01
R4415:Impdh1 UTSW 6 29209222 missense probably damaging 1.00
R4471:Impdh1 UTSW 6 29204632 nonsense probably null
R4777:Impdh1 UTSW 6 29205202 missense possibly damaging 0.95
R5783:Impdh1 UTSW 6 29206343 missense possibly damaging 0.66
R5973:Impdh1 UTSW 6 29207162 missense probably damaging 1.00
R7230:Impdh1 UTSW 6 29206063 splice site probably null
R7512:Impdh1 UTSW 6 29207169 missense probably benign 0.22
R8893:Impdh1 UTSW 6 29216249 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TCTAACTGCGTCTGGGGAAG -3'
(R):5'- GCTTACTTTTCAGCCTGAGTG -3'

Sequencing Primer
(F):5'- TCTGGGGAAGTGCAATGGC -3'
(R):5'- AGCCCTATGGACTCCAGGAC -3'
Posted On 2021-03-08