Incidental Mutation 'R8686:Fam187b'
ID 662041
Institutional Source Beutler Lab
Gene Symbol Fam187b
Ensembl Gene ENSMUSG00000046826
Gene Name family with sequence similarity 187, member B
Synonyms 1700020B09Rik, Tmem162
MMRRC Submission 068541-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.132) question?
Stock # R8686 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 30673219-30689151 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 30676659 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Serine at position 56 (L56S)
Ref Sequence ENSEMBL: ENSMUSP00000057020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001279] [ENSMUST00000058093] [ENSMUST00000098553] [ENSMUST00000108116] [ENSMUST00000128384] [ENSMUST00000129773] [ENSMUST00000147431] [ENSMUST00000205961]
AlphaFold Q0VAY3
Predicted Effect probably benign
Transcript: ENSMUST00000001279
SMART Domains Protein: ENSMUSP00000001279
Gene: ENSMUSG00000001247

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 43 186 1.23e-3 SMART
Pfam:LSR 206 253 9.6e-27 PFAM
low complexity region 280 296 N/A INTRINSIC
low complexity region 445 464 N/A INTRINSIC
low complexity region 468 487 N/A INTRINSIC
low complexity region 496 513 N/A INTRINSIC
low complexity region 544 558 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058093
AA Change: L56S

PolyPhen 2 Score 0.410 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000057020
Gene: ENSMUSG00000046826
AA Change: L56S

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Blast:IG 27 116 4e-30 BLAST
Blast:IG_like 223 290 4e-6 BLAST
transmembrane domain 324 343 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098553
SMART Domains Protein: ENSMUSP00000096153
Gene: ENSMUSG00000001247

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 43 186 1.23e-3 SMART
low complexity region 212 228 N/A INTRINSIC
low complexity region 377 396 N/A INTRINSIC
low complexity region 400 419 N/A INTRINSIC
low complexity region 428 445 N/A INTRINSIC
low complexity region 476 490 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108116
SMART Domains Protein: ENSMUSP00000103751
Gene: ENSMUSG00000001247

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 43 186 1.23e-3 SMART
Pfam:LSR 187 235 2.3e-25 PFAM
low complexity region 261 277 N/A INTRINSIC
low complexity region 426 445 N/A INTRINSIC
low complexity region 449 468 N/A INTRINSIC
low complexity region 477 494 N/A INTRINSIC
low complexity region 525 539 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128384
SMART Domains Protein: ENSMUSP00000144424
Gene: ENSMUSG00000046826

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Blast:IG 45 133 2e-17 BLAST
SCOP:d1wiu__ 53 125 1e-3 SMART
IG_like 238 306 1.9e-2 SMART
transmembrane domain 340 359 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129773
SMART Domains Protein: ENSMUSP00000144533
Gene: ENSMUSG00000046826

DomainStartEndE-ValueType
transmembrane domain 61 80 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147431
SMART Domains Protein: ENSMUSP00000123487
Gene: ENSMUSG00000001247

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
low complexity region 65 81 N/A INTRINSIC
low complexity region 230 249 N/A INTRINSIC
low complexity region 253 272 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205961
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 A G 8: 41,208,521 (GRCm39) T596A probably benign Het
Adamts6 A G 13: 104,450,207 (GRCm39) I303V probably damaging Het
Alpl A T 4: 137,471,112 (GRCm39) H341Q probably damaging Het
Cachd1 G A 4: 100,845,325 (GRCm39) R939H probably damaging Het
Cd22 G A 7: 30,569,494 (GRCm39) R541C probably benign Het
Cenpf A T 1: 189,391,801 (GRCm39) M660K probably benign Het
Cmya5 A T 13: 93,231,888 (GRCm39) S1067T possibly damaging Het
Col5a2 C T 1: 45,461,147 (GRCm39) G250D probably damaging Het
Cylc2 C T 4: 51,229,651 (GRCm39) T331M unknown Het
Dgka A G 10: 128,568,962 (GRCm39) M201T probably benign Het
Dnajc13 T C 9: 104,048,004 (GRCm39) I1804V probably benign Het
Dym T A 18: 75,419,754 (GRCm39) Y642N probably damaging Het
Efr3b A T 12: 4,050,886 (GRCm39) D26E probably damaging Het
Emilin1 A T 5: 31,075,040 (GRCm39) K427M possibly damaging Het
Fbh1 C T 2: 11,760,469 (GRCm39) V694I probably benign Het
Fgd2 C T 17: 29,597,997 (GRCm39) T644I probably benign Het
G6pc1 T G 11: 101,265,533 (GRCm39) probably null Het
Gli2 A G 1: 118,764,417 (GRCm39) S1245P probably benign Het
Gpr137b T C 13: 13,533,991 (GRCm39) Y355C Het
Ighv1-84 T C 12: 115,944,524 (GRCm39) D50G probably benign Het
Impdh1 C A 6: 29,216,214 (GRCm39) probably benign Het
Inhca C T 9: 103,136,627 (GRCm39) A525T probably benign Het
Irf4 A T 13: 30,945,433 (GRCm39) D393V possibly damaging Het
Kalrn A G 16: 34,181,305 (GRCm39) L111P probably damaging Het
Lrch3 T C 16: 32,802,223 (GRCm39) V58A possibly damaging Het
Lrif1 C T 3: 106,640,097 (GRCm39) T394I probably damaging Het
Map4k1 A G 7: 28,693,498 (GRCm39) T434A probably benign Het
Mcur1 G A 13: 43,695,193 (GRCm39) T327M probably damaging Het
Myo9b G T 8: 71,786,966 (GRCm39) S716I probably benign Het
Nol10 T A 12: 17,419,772 (GRCm39) probably benign Het
Nos3 A G 5: 24,573,841 (GRCm39) T202A possibly damaging Het
Odad1 A G 7: 45,597,116 (GRCm39) T456A probably benign Het
Or14j7 T C 17: 38,235,168 (GRCm39) V237A probably benign Het
Or2d4 A C 7: 106,543,905 (GRCm39) M101R probably benign Het
Parp12 A T 6: 39,094,856 (GRCm39) S80T probably benign Het
Pde1a C T 2: 79,758,086 (GRCm39) V50I probably benign Het
Pfkl A T 10: 77,833,356 (GRCm39) probably null Het
Phkg1 A T 5: 129,895,056 (GRCm39) Y207N probably damaging Het
Pik3r4 A G 9: 105,535,728 (GRCm39) T640A possibly damaging Het
Pip5k1c C A 10: 81,147,827 (GRCm39) H411N probably damaging Het
Pla2g4e A G 2: 120,075,172 (GRCm39) S73P probably damaging Het
Polr2b T C 5: 77,483,510 (GRCm39) V662A probably damaging Het
Prss43 C T 9: 110,658,494 (GRCm39) R265C possibly damaging Het
Rap1b A T 10: 117,658,746 (GRCm39) V29D probably damaging Het
Rraga A G 4: 86,495,048 (GRCm39) E298G probably damaging Het
Rrp8 A T 7: 105,382,781 (GRCm39) I418N probably damaging Het
Siglecf T C 7: 43,005,030 (GRCm39) V420A probably benign Het
Snx14 T A 9: 88,297,746 (GRCm39) N174I probably damaging Het
Speer4e1 T C 5: 14,984,129 (GRCm39) N229S probably benign Het
Spopfm2 T C 3: 94,083,427 (GRCm39) D128G probably benign Het
Teddm3 A G 16: 20,971,685 (GRCm39) *295Q probably null Het
Tfap2c A G 2: 172,393,926 (GRCm39) D245G possibly damaging Het
Tfap2d A G 1: 19,178,508 (GRCm39) N191S probably benign Het
Tmt1b A T 10: 128,796,476 (GRCm39) M111K possibly damaging Het
Unc80 A G 1: 66,651,427 (GRCm39) R1591G possibly damaging Het
Vmn1r116 T C 7: 20,606,616 (GRCm39) W146R probably damaging Het
Vps13b C G 15: 35,925,535 (GRCm39) S3823R probably damaging Het
Wiz T A 17: 32,586,821 (GRCm39) D163V probably damaging Het
Xylt1 G C 7: 116,980,594 (GRCm39) A61P unknown Het
Zfp521 A C 18: 13,978,701 (GRCm39) F571V probably damaging Het
Zfp664 T A 5: 124,963,133 (GRCm39) C176S possibly damaging Het
Zfyve26 T C 12: 79,334,227 (GRCm39) N264D probably benign Het
Other mutations in Fam187b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0131:Fam187b UTSW 7 30,688,545 (GRCm39) missense probably damaging 1.00
R0131:Fam187b UTSW 7 30,688,545 (GRCm39) missense probably damaging 1.00
R0132:Fam187b UTSW 7 30,688,545 (GRCm39) missense probably damaging 1.00
R0594:Fam187b UTSW 7 30,676,579 (GRCm39) nonsense probably null
R1728:Fam187b UTSW 7 30,688,445 (GRCm39) nonsense probably null
R2965:Fam187b UTSW 7 30,677,154 (GRCm39) missense probably benign 0.44
R3104:Fam187b UTSW 7 30,676,665 (GRCm39) missense probably benign 0.00
R3106:Fam187b UTSW 7 30,676,665 (GRCm39) missense probably benign 0.00
R4607:Fam187b UTSW 7 30,677,170 (GRCm39) missense probably benign 0.28
R4608:Fam187b UTSW 7 30,677,170 (GRCm39) missense probably benign 0.28
R4612:Fam187b UTSW 7 30,676,518 (GRCm39) missense possibly damaging 0.69
R4672:Fam187b UTSW 7 30,676,968 (GRCm39) missense probably damaging 1.00
R4801:Fam187b UTSW 7 30,676,515 (GRCm39) missense possibly damaging 0.84
R4802:Fam187b UTSW 7 30,676,515 (GRCm39) missense possibly damaging 0.84
R4959:Fam187b UTSW 7 30,681,687 (GRCm39) missense probably damaging 1.00
R5820:Fam187b UTSW 7 30,676,577 (GRCm39) missense probably damaging 1.00
R6351:Fam187b UTSW 7 30,677,024 (GRCm39) missense probably damaging 1.00
R6624:Fam187b UTSW 7 30,676,612 (GRCm39) missense probably benign 0.26
R6823:Fam187b UTSW 7 30,688,715 (GRCm39) missense probably benign 0.01
R7725:Fam187b UTSW 7 30,677,139 (GRCm39) missense possibly damaging 0.91
R9342:Fam187b UTSW 7 30,677,185 (GRCm39) nonsense probably null
R9350:Fam187b UTSW 7 30,677,037 (GRCm39) missense possibly damaging 0.79
R9403:Fam187b UTSW 7 30,676,515 (GRCm39) missense
R9443:Fam187b UTSW 7 30,677,067 (GRCm39) missense probably damaging 1.00
X0063:Fam187b UTSW 7 30,688,745 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTGTCTAGTTTAGTCAGCCATGC -3'
(R):5'- ATTTCCCATGGGCTCTTGGC -3'

Sequencing Primer
(F):5'- CCATGCTGGCTACTCTGTGG -3'
(R):5'- AGTGATGTGCAACAGAGCTATGTTC -3'
Posted On 2021-03-08