Incidental Mutation 'R8686:Or2d4'
ID 662045
Institutional Source Beutler Lab
Gene Symbol Or2d4
Ensembl Gene ENSMUSG00000045581
Gene Name olfactory receptor family 2 subfamily D member 4
Synonyms MOR260-3, Olfr710, GA_x6K02T2PBJ9-9325348-9324416
MMRRC Submission 068541-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R8686 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 106543274-106547519 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 106543905 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Arginine at position 101 (M101R)
Ref Sequence ENSEMBL: ENSMUSP00000062956 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055923]
AlphaFold Q9EP55
Predicted Effect probably benign
Transcript: ENSMUST00000055923
AA Change: M101R

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000062956
Gene: ENSMUSG00000045581
AA Change: M101R

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.1e-53 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.9e-9 PFAM
Pfam:7tm_1 41 290 1.2e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 A G 8: 41,208,521 (GRCm39) T596A probably benign Het
Adamts6 A G 13: 104,450,207 (GRCm39) I303V probably damaging Het
Alpl A T 4: 137,471,112 (GRCm39) H341Q probably damaging Het
Cachd1 G A 4: 100,845,325 (GRCm39) R939H probably damaging Het
Cd22 G A 7: 30,569,494 (GRCm39) R541C probably benign Het
Cenpf A T 1: 189,391,801 (GRCm39) M660K probably benign Het
Cmya5 A T 13: 93,231,888 (GRCm39) S1067T possibly damaging Het
Col5a2 C T 1: 45,461,147 (GRCm39) G250D probably damaging Het
Cylc2 C T 4: 51,229,651 (GRCm39) T331M unknown Het
Dgka A G 10: 128,568,962 (GRCm39) M201T probably benign Het
Dnajc13 T C 9: 104,048,004 (GRCm39) I1804V probably benign Het
Dym T A 18: 75,419,754 (GRCm39) Y642N probably damaging Het
Efr3b A T 12: 4,050,886 (GRCm39) D26E probably damaging Het
Emilin1 A T 5: 31,075,040 (GRCm39) K427M possibly damaging Het
Fam187b T C 7: 30,676,659 (GRCm39) L56S probably benign Het
Fbh1 C T 2: 11,760,469 (GRCm39) V694I probably benign Het
Fgd2 C T 17: 29,597,997 (GRCm39) T644I probably benign Het
G6pc1 T G 11: 101,265,533 (GRCm39) probably null Het
Gli2 A G 1: 118,764,417 (GRCm39) S1245P probably benign Het
Gpr137b T C 13: 13,533,991 (GRCm39) Y355C Het
Ighv1-84 T C 12: 115,944,524 (GRCm39) D50G probably benign Het
Impdh1 C A 6: 29,216,214 (GRCm39) probably benign Het
Inhca C T 9: 103,136,627 (GRCm39) A525T probably benign Het
Irf4 A T 13: 30,945,433 (GRCm39) D393V possibly damaging Het
Kalrn A G 16: 34,181,305 (GRCm39) L111P probably damaging Het
Lrch3 T C 16: 32,802,223 (GRCm39) V58A possibly damaging Het
Lrif1 C T 3: 106,640,097 (GRCm39) T394I probably damaging Het
Map4k1 A G 7: 28,693,498 (GRCm39) T434A probably benign Het
Mcur1 G A 13: 43,695,193 (GRCm39) T327M probably damaging Het
Myo9b G T 8: 71,786,966 (GRCm39) S716I probably benign Het
Nol10 T A 12: 17,419,772 (GRCm39) probably benign Het
Nos3 A G 5: 24,573,841 (GRCm39) T202A possibly damaging Het
Odad1 A G 7: 45,597,116 (GRCm39) T456A probably benign Het
Or14j7 T C 17: 38,235,168 (GRCm39) V237A probably benign Het
Parp12 A T 6: 39,094,856 (GRCm39) S80T probably benign Het
Pde1a C T 2: 79,758,086 (GRCm39) V50I probably benign Het
Pfkl A T 10: 77,833,356 (GRCm39) probably null Het
Phkg1 A T 5: 129,895,056 (GRCm39) Y207N probably damaging Het
Pik3r4 A G 9: 105,535,728 (GRCm39) T640A possibly damaging Het
Pip5k1c C A 10: 81,147,827 (GRCm39) H411N probably damaging Het
Pla2g4e A G 2: 120,075,172 (GRCm39) S73P probably damaging Het
Polr2b T C 5: 77,483,510 (GRCm39) V662A probably damaging Het
Prss43 C T 9: 110,658,494 (GRCm39) R265C possibly damaging Het
Rap1b A T 10: 117,658,746 (GRCm39) V29D probably damaging Het
Rraga A G 4: 86,495,048 (GRCm39) E298G probably damaging Het
Rrp8 A T 7: 105,382,781 (GRCm39) I418N probably damaging Het
Siglecf T C 7: 43,005,030 (GRCm39) V420A probably benign Het
Snx14 T A 9: 88,297,746 (GRCm39) N174I probably damaging Het
Speer4e1 T C 5: 14,984,129 (GRCm39) N229S probably benign Het
Spopfm2 T C 3: 94,083,427 (GRCm39) D128G probably benign Het
Teddm3 A G 16: 20,971,685 (GRCm39) *295Q probably null Het
Tfap2c A G 2: 172,393,926 (GRCm39) D245G possibly damaging Het
Tfap2d A G 1: 19,178,508 (GRCm39) N191S probably benign Het
Tmt1b A T 10: 128,796,476 (GRCm39) M111K possibly damaging Het
Unc80 A G 1: 66,651,427 (GRCm39) R1591G possibly damaging Het
Vmn1r116 T C 7: 20,606,616 (GRCm39) W146R probably damaging Het
Vps13b C G 15: 35,925,535 (GRCm39) S3823R probably damaging Het
Wiz T A 17: 32,586,821 (GRCm39) D163V probably damaging Het
Xylt1 G C 7: 116,980,594 (GRCm39) A61P unknown Het
Zfp521 A C 18: 13,978,701 (GRCm39) F571V probably damaging Het
Zfp664 T A 5: 124,963,133 (GRCm39) C176S possibly damaging Het
Zfyve26 T C 12: 79,334,227 (GRCm39) N264D probably benign Het
Other mutations in Or2d4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01432:Or2d4 APN 7 106,543,748 (GRCm39) missense possibly damaging 0.77
IGL01534:Or2d4 APN 7 106,543,546 (GRCm39) missense probably damaging 1.00
IGL02041:Or2d4 APN 7 106,543,320 (GRCm39) missense possibly damaging 0.78
IGL02414:Or2d4 APN 7 106,543,965 (GRCm39) missense probably benign 0.33
IGL02695:Or2d4 APN 7 106,543,870 (GRCm39) missense possibly damaging 0.93
IGL03167:Or2d4 APN 7 106,543,852 (GRCm39) missense probably damaging 0.99
IGL03242:Or2d4 APN 7 106,544,125 (GRCm39) missense possibly damaging 0.59
R1985:Or2d4 UTSW 7 106,544,133 (GRCm39) missense probably benign 0.00
R2234:Or2d4 UTSW 7 106,543,827 (GRCm39) missense probably damaging 1.00
R3414:Or2d4 UTSW 7 106,543,383 (GRCm39) nonsense probably null
R3731:Or2d4 UTSW 7 106,543,684 (GRCm39) missense probably damaging 0.99
R3777:Or2d4 UTSW 7 106,543,519 (GRCm39) missense probably benign 0.05
R4646:Or2d4 UTSW 7 106,543,547 (GRCm39) missense probably benign 0.01
R4647:Or2d4 UTSW 7 106,543,547 (GRCm39) missense probably benign 0.01
R4661:Or2d4 UTSW 7 106,544,074 (GRCm39) missense probably damaging 0.98
R4679:Or2d4 UTSW 7 106,544,152 (GRCm39) missense probably benign 0.10
R5200:Or2d4 UTSW 7 106,544,187 (GRCm39) missense possibly damaging 0.77
R5495:Or2d4 UTSW 7 106,543,699 (GRCm39) nonsense probably null
R6744:Or2d4 UTSW 7 106,543,741 (GRCm39) missense probably damaging 1.00
R6908:Or2d4 UTSW 7 106,543,839 (GRCm39) missense possibly damaging 0.82
R7463:Or2d4 UTSW 7 106,543,380 (GRCm39) missense probably damaging 0.99
R7498:Or2d4 UTSW 7 106,543,575 (GRCm39) missense possibly damaging 0.93
R9283:Or2d4 UTSW 7 106,543,806 (GRCm39) missense probably benign 0.01
RF003:Or2d4 UTSW 7 106,543,855 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAAGAGTGCAGGAGGCTCAC -3'
(R):5'- GGAACCTGCTCATCATACTCC -3'

Sequencing Primer
(F):5'- ATTGATTATATTTGGTCCCCGGTAC -3'
(R):5'- CATCATACTCCTCATTCATGTTGAC -3'
Posted On 2021-03-08