Incidental Mutation 'R8686:Xylt1'
ID 662046
Institutional Source Beutler Lab
Gene Symbol Xylt1
Ensembl Gene ENSMUSG00000030657
Gene Name xylosyltransferase 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock # R8686 (G1)
Quality Score 122.008
Status Not validated
Chromosome 7
Chromosomal Location 117380979-117673580 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to C at 117381359 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Proline at position 61 (A61P)
Ref Sequence ENSEMBL: ENSMUSP00000032892 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032892]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000032892
AA Change: A61P
SMART Domains Protein: ENSMUSP00000032892
Gene: ENSMUSG00000030657
AA Change: A61P

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 41 68 N/A INTRINSIC
low complexity region 75 104 N/A INTRINSIC
Pfam:Branch 322 577 7.8e-53 PFAM
Pfam:Xylo_C 607 787 2.6e-73 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a xylosyltransferase enzyme. The encoded protein catalyzes transfer of UDP-xylose to serine residues of an acceptor protein substrate. This transfer reaction is necessary for biosynthesis of glycosaminoglycan chains. Mutations in this gene have been associated with increased severity of pseudoxanthoma elasticum.[provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit partial preweaning lethality, impaired chondrocyte maturation and decreased skeletal length. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik C T 9: 103,259,428 A525T probably benign Het
Adam25 A G 8: 40,755,484 T596A probably benign Het
Adamts6 A G 13: 104,313,699 I303V probably damaging Het
Alpl A T 4: 137,743,801 H341Q probably damaging Het
Cachd1 G A 4: 100,988,128 R939H probably damaging Het
Ccdc114 A G 7: 45,947,692 T456A probably benign Het
Cd22 G A 7: 30,870,069 R541C probably benign Het
Cenpf A T 1: 189,659,604 M660K probably benign Het
Cmya5 A T 13: 93,095,380 S1067T possibly damaging Het
Col5a2 C T 1: 45,421,987 G250D probably damaging Het
Cylc2 C T 4: 51,229,651 T331M unknown Het
Dgka A G 10: 128,733,093 M201T probably benign Het
Dnajc13 T C 9: 104,170,805 I1804V probably benign Het
Dym T A 18: 75,286,683 Y642N probably damaging Het
Efr3b A T 12: 4,000,886 D26E probably damaging Het
Emilin1 A T 5: 30,917,696 K427M possibly damaging Het
Fam187b T C 7: 30,977,234 L56S probably benign Het
Fbxo18 C T 2: 11,755,658 V694I probably benign Het
Fgd2 C T 17: 29,379,023 T644I probably benign Het
G6pc T G 11: 101,374,707 probably null Het
Gli2 A G 1: 118,836,687 S1245P probably benign Het
Gm10696 T C 3: 94,176,120 D128G probably benign Het
Gpr137b T C 13: 13,359,406 Y355C Het
Ighv1-84 T C 12: 115,980,904 D50G probably benign Het
Impdh1 C A 6: 29,216,215 probably benign Het
Irf4 A T 13: 30,761,450 D393V possibly damaging Het
Kalrn A G 16: 34,360,935 L111P probably damaging Het
Lrch3 T C 16: 32,981,853 V58A possibly damaging Het
Lrif1 C T 3: 106,732,781 T394I probably damaging Het
Map4k1 A G 7: 28,994,073 T434A probably benign Het
Mcur1 G A 13: 43,541,717 T327M probably damaging Het
Mettl7b A T 10: 128,960,607 M111K possibly damaging Het
Myo9b G T 8: 71,334,322 S716I probably benign Het
Nol10 T A 12: 17,369,771 probably benign Het
Nos3 A G 5: 24,368,843 T202A possibly damaging Het
Olfr128 T C 17: 37,924,277 V237A probably benign Het
Olfr710 A C 7: 106,944,698 M101R probably benign Het
Parp12 A T 6: 39,117,922 S80T probably benign Het
Pde1a C T 2: 79,927,742 V50I probably benign Het
Pfkl A T 10: 77,997,522 probably null Het
Phkg1 A T 5: 129,866,215 Y207N probably damaging Het
Pik3r4 A G 9: 105,658,529 T640A possibly damaging Het
Pip5k1c C A 10: 81,311,993 H411N probably damaging Het
Pla2g4e A G 2: 120,244,691 S73P probably damaging Het
Polr2b T C 5: 77,335,663 V662A probably damaging Het
Prss43 C T 9: 110,829,426 R265C possibly damaging Het
Rap1b A T 10: 117,822,841 V29D probably damaging Het
Rraga A G 4: 86,576,811 E298G probably damaging Het
Rrp8 A T 7: 105,733,574 I418N probably damaging Het
Siglecf T C 7: 43,355,606 V420A probably benign Het
Snx14 T A 9: 88,415,693 N174I probably damaging Het
Speer4e T C 5: 14,934,115 N229S probably benign Het
Teddm3 A G 16: 21,152,935 *295Q probably null Het
Tfap2c A G 2: 172,552,006 D245G possibly damaging Het
Tfap2d A G 1: 19,108,284 N191S probably benign Het
Unc80 A G 1: 66,612,268 R1591G possibly damaging Het
Vmn1r116 T C 7: 20,872,691 W146R probably damaging Het
Vps13b C G 15: 35,925,389 S3823R probably damaging Het
Wiz T A 17: 32,367,847 D163V probably damaging Het
Zfp521 A C 18: 13,845,644 F571V probably damaging Het
Zfp664 T A 5: 124,886,069 C176S possibly damaging Het
Zfyve26 T C 12: 79,287,453 N264D probably benign Het
Other mutations in Xylt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Xylt1 APN 7 117650685 missense probably damaging 0.99
IGL01306:Xylt1 APN 7 117548890 missense probably benign 0.00
IGL01656:Xylt1 APN 7 117548993 missense probably damaging 1.00
IGL02152:Xylt1 APN 7 117634770 missense probably damaging 1.00
IGL02188:Xylt1 APN 7 117634737 missense probably damaging 1.00
IGL02732:Xylt1 APN 7 117591937 missense possibly damaging 0.75
IGL02944:Xylt1 APN 7 117634757 missense probably benign 0.00
IGL03308:Xylt1 APN 7 117637751 nonsense probably null
IGL03393:Xylt1 APN 7 117593713 missense probably damaging 1.00
phloem UTSW 7 117656584 missense probably damaging 1.00
xylem UTSW 7 117592036 missense probably damaging 1.00
ANU23:Xylt1 UTSW 7 117548890 missense probably benign 0.00
PIT4378001:Xylt1 UTSW 7 117548865 missense possibly damaging 0.83
R0023:Xylt1 UTSW 7 117634701 missense probably damaging 1.00
R0023:Xylt1 UTSW 7 117634701 missense probably damaging 1.00
R0970:Xylt1 UTSW 7 117634736 missense probably damaging 0.96
R1433:Xylt1 UTSW 7 117591952 missense possibly damaging 0.51
R1762:Xylt1 UTSW 7 117637761 missense probably benign 0.00
R2169:Xylt1 UTSW 7 117667437 missense probably damaging 1.00
R2937:Xylt1 UTSW 7 117634784 missense probably benign 0.04
R3024:Xylt1 UTSW 7 117548648 missense probably damaging 1.00
R3855:Xylt1 UTSW 7 117593550 missense probably damaging 1.00
R4006:Xylt1 UTSW 7 117475513 missense probably benign 0.01
R4329:Xylt1 UTSW 7 117656461 missense probably damaging 1.00
R4794:Xylt1 UTSW 7 117637635 missense probably benign 0.07
R4975:Xylt1 UTSW 7 117667342 missense probably damaging 1.00
R5225:Xylt1 UTSW 7 117592036 missense probably damaging 1.00
R5679:Xylt1 UTSW 7 117643650 missense probably damaging 1.00
R5707:Xylt1 UTSW 7 117656494 missense possibly damaging 0.95
R5756:Xylt1 UTSW 7 117650700 missense probably damaging 0.97
R5802:Xylt1 UTSW 7 117656691 missense probably benign 0.43
R6057:Xylt1 UTSW 7 117591908 missense probably benign 0.02
R6249:Xylt1 UTSW 7 117667305 missense probably benign 0.11
R6298:Xylt1 UTSW 7 117656737 missense probably damaging 0.96
R7159:Xylt1 UTSW 7 117637602 missense probably damaging 1.00
R7198:Xylt1 UTSW 7 117656584 missense probably damaging 1.00
R7323:Xylt1 UTSW 7 117592047 critical splice donor site probably null
R7449:Xylt1 UTSW 7 117592005 missense possibly damaging 0.55
R7545:Xylt1 UTSW 7 117593585 missense probably benign 0.11
R7786:Xylt1 UTSW 7 117643475 splice site probably null
R7849:Xylt1 UTSW 7 117656668 missense probably benign 0.06
R7867:Xylt1 UTSW 7 117475514 missense probably benign 0.12
R8169:Xylt1 UTSW 7 117650619 missense probably damaging 0.99
R8942:Xylt1 UTSW 7 117634744 nonsense probably null
R9019:Xylt1 UTSW 7 117650811 critical splice donor site probably null
R9209:Xylt1 UTSW 7 117656647 missense probably benign 0.02
R9393:Xylt1 UTSW 7 117643679 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTGCCCGTCTGAAAACTCC -3'
(R):5'- TCGAGATCCCCTTCCCAAAG -3'

Sequencing Primer
(F):5'- TCTGAAAACTCCGCGCCG -3'
(R):5'- AAAGGGCACCTTACCCTC -3'
Posted On 2021-03-08