Incidental Mutation 'R8686:1300017J02Rik'
ID 662050
Institutional Source Beutler Lab
Gene Symbol 1300017J02Rik
Ensembl Gene ENSMUSG00000033688
Gene Name RIKEN cDNA 1300017J02 gene
Synonyms mICA
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock # R8686 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 103250521-103305082 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 103259428 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 525 (A525T)
Ref Sequence ENSEMBL: ENSMUSP00000035163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035163] [ENSMUST00000123530]
AlphaFold Q9DBD0
PDB Structure Crystal Structure of the Murine Inhibitor of Carbonic Anhydrase [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000035163
AA Change: A525T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000035163
Gene: ENSMUSG00000033688
AA Change: A525T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
TR_FER 25 352 5.48e-163 SMART
TR_FER 355 697 3.26e-179 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123530
AA Change: A447T

PolyPhen 2 Score 0.167 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000115867
Gene: ENSMUSG00000033688
AA Change: A447T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
TR_FER 25 351 3.67e-164 SMART
TR_FER 352 619 5.89e-104 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000123519
Gene: ENSMUSG00000033688
AA Change: A88T

DomainStartEndE-ValueType
TR_FER 1 242 5.88e-81 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 A G 8: 40,755,484 T596A probably benign Het
Adamts6 A G 13: 104,313,699 I303V probably damaging Het
Alpl A T 4: 137,743,801 H341Q probably damaging Het
Cachd1 G A 4: 100,988,128 R939H probably damaging Het
Ccdc114 A G 7: 45,947,692 T456A probably benign Het
Cd22 G A 7: 30,870,069 R541C probably benign Het
Cenpf A T 1: 189,659,604 M660K probably benign Het
Cmya5 A T 13: 93,095,380 S1067T possibly damaging Het
Col5a2 C T 1: 45,421,987 G250D probably damaging Het
Cylc2 C T 4: 51,229,651 T331M unknown Het
Dgka A G 10: 128,733,093 M201T probably benign Het
Dnajc13 T C 9: 104,170,805 I1804V probably benign Het
Dym T A 18: 75,286,683 Y642N probably damaging Het
Efr3b A T 12: 4,000,886 D26E probably damaging Het
Emilin1 A T 5: 30,917,696 K427M possibly damaging Het
Fam187b T C 7: 30,977,234 L56S probably benign Het
Fbxo18 C T 2: 11,755,658 V694I probably benign Het
Fgd2 C T 17: 29,379,023 T644I probably benign Het
G6pc T G 11: 101,374,707 probably null Het
Gli2 A G 1: 118,836,687 S1245P probably benign Het
Gm10696 T C 3: 94,176,120 D128G probably benign Het
Gpr137b T C 13: 13,359,406 Y355C Het
Ighv1-84 T C 12: 115,980,904 D50G probably benign Het
Impdh1 C A 6: 29,216,215 probably benign Het
Irf4 A T 13: 30,761,450 D393V possibly damaging Het
Kalrn A G 16: 34,360,935 L111P probably damaging Het
Lrch3 T C 16: 32,981,853 V58A possibly damaging Het
Lrif1 C T 3: 106,732,781 T394I probably damaging Het
Map4k1 A G 7: 28,994,073 T434A probably benign Het
Mcur1 G A 13: 43,541,717 T327M probably damaging Het
Mettl7b A T 10: 128,960,607 M111K possibly damaging Het
Myo9b G T 8: 71,334,322 S716I probably benign Het
Nol10 T A 12: 17,369,771 probably benign Het
Nos3 A G 5: 24,368,843 T202A possibly damaging Het
Olfr128 T C 17: 37,924,277 V237A probably benign Het
Olfr710 A C 7: 106,944,698 M101R probably benign Het
Parp12 A T 6: 39,117,922 S80T probably benign Het
Pde1a C T 2: 79,927,742 V50I probably benign Het
Pfkl A T 10: 77,997,522 probably null Het
Phkg1 A T 5: 129,866,215 Y207N probably damaging Het
Pik3r4 A G 9: 105,658,529 T640A possibly damaging Het
Pip5k1c C A 10: 81,311,993 H411N probably damaging Het
Pla2g4e A G 2: 120,244,691 S73P probably damaging Het
Polr2b T C 5: 77,335,663 V662A probably damaging Het
Prss43 C T 9: 110,829,426 R265C possibly damaging Het
Rap1b A T 10: 117,822,841 V29D probably damaging Het
Rraga A G 4: 86,576,811 E298G probably damaging Het
Rrp8 A T 7: 105,733,574 I418N probably damaging Het
Siglecf T C 7: 43,355,606 V420A probably benign Het
Snx14 T A 9: 88,415,693 N174I probably damaging Het
Speer4e T C 5: 14,934,115 N229S probably benign Het
Teddm3 A G 16: 21,152,935 *295Q probably null Het
Tfap2c A G 2: 172,552,006 D245G possibly damaging Het
Tfap2d A G 1: 19,108,284 N191S probably benign Het
Unc80 A G 1: 66,612,268 R1591G possibly damaging Het
Vmn1r116 T C 7: 20,872,691 W146R probably damaging Het
Vps13b C G 15: 35,925,389 S3823R probably damaging Het
Wiz T A 17: 32,367,847 D163V probably damaging Het
Xylt1 G C 7: 117,381,359 A61P unknown Het
Zfp521 A C 18: 13,845,644 F571V probably damaging Het
Zfp664 T A 5: 124,886,069 C176S possibly damaging Het
Zfyve26 T C 12: 79,287,453 N264D probably benign Het
Other mutations in 1300017J02Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01371:1300017J02Rik APN 9 103254776 missense possibly damaging 0.48
IGL02370:1300017J02Rik APN 9 103263074 missense probably benign 0.27
IGL02899:1300017J02Rik APN 9 103277574 missense probably damaging 1.00
R0206:1300017J02Rik UTSW 9 103282662 missense probably damaging 1.00
R0206:1300017J02Rik UTSW 9 103282662 missense probably damaging 1.00
R0831:1300017J02Rik UTSW 9 103269779 missense possibly damaging 0.50
R0849:1300017J02Rik UTSW 9 103263057 missense possibly damaging 0.94
R1225:1300017J02Rik UTSW 9 103254839 splice site probably benign
R2061:1300017J02Rik UTSW 9 103268314 missense probably benign 0.01
R2176:1300017J02Rik UTSW 9 103259367 splice site probably benign
R4915:1300017J02Rik UTSW 9 103251855 nonsense probably null
R4917:1300017J02Rik UTSW 9 103251855 nonsense probably null
R5020:1300017J02Rik UTSW 9 103282502 missense probably benign 0.02
R5033:1300017J02Rik UTSW 9 103279414 missense probably benign 0.36
R5087:1300017J02Rik UTSW 9 103266221 missense probably damaging 0.98
R5174:1300017J02Rik UTSW 9 103282556 splice site probably null
R6283:1300017J02Rik UTSW 9 103282635 nonsense probably null
R7092:1300017J02Rik UTSW 9 103281043 missense possibly damaging 0.55
R7175:1300017J02Rik UTSW 9 103251789 critical splice donor site probably null
R7347:1300017J02Rik UTSW 9 103282646 missense possibly damaging 0.67
R7380:1300017J02Rik UTSW 9 103279481 nonsense probably null
R7400:1300017J02Rik UTSW 9 103250662 missense probably benign 0.25
R7460:1300017J02Rik UTSW 9 103254648 missense probably benign 0.00
R7993:1300017J02Rik UTSW 9 103263133 missense probably benign
R8056:1300017J02Rik UTSW 9 103266224 missense probably damaging 1.00
R8869:1300017J02Rik UTSW 9 103272632 missense probably damaging 1.00
R9371:1300017J02Rik UTSW 9 103281053 missense probably benign 0.01
R9448:1300017J02Rik UTSW 9 103272582 missense probably benign
R9719:1300017J02Rik UTSW 9 103254815 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- TGGGCCAAGGGAGTATTCTTTATAG -3'
(R):5'- CTTGTGTTGCAGGCAGTCTCAG -3'

Sequencing Primer
(F):5'- GGGAGTATTCTTTATAGAACCAGGC -3'
(R):5'- GGCAGTCTCAGGGACAAACCTC -3'
Posted On 2021-03-08