Incidental Mutation 'R8686:1300017J02Rik'
ID662050
Institutional Source Beutler Lab
Gene Symbol 1300017J02Rik
Ensembl Gene ENSMUSG00000033688
Gene NameRIKEN cDNA 1300017J02 gene
SynonymsmICA
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.429) question?
Stock #R8686 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location103250521-103305082 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 103259428 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 525 (A525T)
Ref Sequence ENSEMBL: ENSMUSP00000035163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035163] [ENSMUST00000123530]
PDB Structure Crystal Structure of the Murine Inhibitor of Carbonic Anhydrase [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000035163
AA Change: A525T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000035163
Gene: ENSMUSG00000033688
AA Change: A525T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
TR_FER 25 352 5.48e-163 SMART
TR_FER 355 697 3.26e-179 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123530
AA Change: A447T

PolyPhen 2 Score 0.167 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000115867
Gene: ENSMUSG00000033688
AA Change: A447T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
TR_FER 25 351 3.67e-164 SMART
TR_FER 352 619 5.89e-104 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000123519
Gene: ENSMUSG00000033688
AA Change: A88T

DomainStartEndE-ValueType
TR_FER 1 242 5.88e-81 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 A G 8: 40,755,484 T596A probably benign Het
Adamts6 A G 13: 104,313,699 I303V probably damaging Het
Alpl A T 4: 137,743,801 H341Q probably damaging Het
Cachd1 G A 4: 100,988,128 R939H probably damaging Het
Ccdc114 A G 7: 45,947,692 T456A probably benign Het
Cd22 G A 7: 30,870,069 R541C probably benign Het
Cenpf A T 1: 189,659,604 M660K probably benign Het
Cmya5 A T 13: 93,095,380 S1067T possibly damaging Het
Col5a2 C T 1: 45,421,987 G250D probably damaging Het
Cylc2 C T 4: 51,229,651 T331M unknown Het
Dgka A G 10: 128,733,093 M201T probably benign Het
Dnajc13 T C 9: 104,170,805 I1804V probably benign Het
Dym T A 18: 75,286,683 Y642N probably damaging Het
Efr3b A T 12: 4,000,886 D26E probably damaging Het
Emilin1 A T 5: 30,917,696 K427M possibly damaging Het
Fam187b T C 7: 30,977,234 L56S probably benign Het
Fbxo18 C T 2: 11,755,658 V694I probably benign Het
Fgd2 C T 17: 29,379,023 T644I probably benign Het
G6pc T G 11: 101,374,707 probably null Het
Gli2 A G 1: 118,836,687 S1245P probably benign Het
Gm10696 T C 3: 94,176,120 D128G probably benign Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Ighv1-84 T C 12: 115,980,904 D50G probably benign Het
Impdh1 C A 6: 29,216,215 probably benign Het
Irf4 A T 13: 30,761,450 D393V possibly damaging Het
Kalrn A G 16: 34,360,935 L111P probably damaging Het
Lrch3 T C 16: 32,981,853 V58A possibly damaging Het
Lrif1 C T 3: 106,732,781 T394I probably damaging Het
Map4k1 A G 7: 28,994,073 T434A probably benign Het
Mcur1 G A 13: 43,541,717 T327M probably damaging Het
Mettl7b A T 10: 128,960,607 M111K possibly damaging Het
Myo9b G T 8: 71,334,322 S716I probably benign Het
Nos3 A G 5: 24,368,843 T202A possibly damaging Het
Olfr128 T C 17: 37,924,277 V237A probably benign Het
Olfr710 A C 7: 106,944,698 M101R probably benign Het
Parp12 A T 6: 39,117,922 S80T probably benign Het
Pde1a C T 2: 79,927,742 V50I probably benign Het
Pfkl A T 10: 77,997,522 probably null Het
Phkg1 A T 5: 129,866,215 Y207N probably damaging Het
Pik3r4 A G 9: 105,658,529 T640A possibly damaging Het
Pip5k1c C A 10: 81,311,993 H411N probably damaging Het
Pla2g4e A G 2: 120,244,691 S73P probably damaging Het
Polr2b T C 5: 77,335,663 V662A probably damaging Het
Prss43 C T 9: 110,829,426 R265C possibly damaging Het
Rap1b A T 10: 117,822,841 V29D probably damaging Het
Rraga A G 4: 86,576,811 E298G probably damaging Het
Rrp8 A T 7: 105,733,574 I418N probably damaging Het
Siglecf T C 7: 43,355,606 V420A probably benign Het
Snx14 T A 9: 88,415,693 N174I probably damaging Het
Speer4e T C 5: 14,934,115 N229S probably benign Het
Teddm3 A G 16: 21,152,935 *295Q probably null Het
Tfap2c A G 2: 172,552,006 D245G possibly damaging Het
Tfap2d A G 1: 19,108,284 N191S probably benign Het
Unc80 A G 1: 66,612,268 R1591G possibly damaging Het
Vmn1r116 T C 7: 20,872,691 W146R probably damaging Het
Vps13b C G 15: 35,925,389 S3823R probably damaging Het
Wiz T A 17: 32,367,847 D163V probably damaging Het
Xylt1 G C 7: 117,381,359 A61P unknown Het
Zfp521 A C 18: 13,845,644 F571V probably damaging Het
Zfp664 T A 5: 124,886,069 C176S possibly damaging Het
Zfyve26 T C 12: 79,287,453 N264D probably benign Het
Other mutations in 1300017J02Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01371:1300017J02Rik APN 9 103254776 missense possibly damaging 0.48
IGL02370:1300017J02Rik APN 9 103263074 missense probably benign 0.27
IGL02899:1300017J02Rik APN 9 103277574 missense probably damaging 1.00
R0206:1300017J02Rik UTSW 9 103282662 missense probably damaging 1.00
R0206:1300017J02Rik UTSW 9 103282662 missense probably damaging 1.00
R0831:1300017J02Rik UTSW 9 103269779 missense possibly damaging 0.50
R0849:1300017J02Rik UTSW 9 103263057 missense possibly damaging 0.94
R1225:1300017J02Rik UTSW 9 103254839 splice site probably benign
R2061:1300017J02Rik UTSW 9 103268314 missense probably benign 0.01
R2176:1300017J02Rik UTSW 9 103259367 splice site probably benign
R4915:1300017J02Rik UTSW 9 103251855 nonsense probably null
R4917:1300017J02Rik UTSW 9 103251855 nonsense probably null
R5020:1300017J02Rik UTSW 9 103282502 missense probably benign 0.02
R5033:1300017J02Rik UTSW 9 103279414 missense probably benign 0.36
R5087:1300017J02Rik UTSW 9 103266221 missense probably damaging 0.98
R5174:1300017J02Rik UTSW 9 103282556 splice site probably null
R6283:1300017J02Rik UTSW 9 103282635 nonsense probably null
R7092:1300017J02Rik UTSW 9 103281043 missense possibly damaging 0.55
R7175:1300017J02Rik UTSW 9 103251789 critical splice donor site probably null
R7347:1300017J02Rik UTSW 9 103282646 missense possibly damaging 0.67
R7380:1300017J02Rik UTSW 9 103279481 nonsense probably null
R7400:1300017J02Rik UTSW 9 103250662 missense probably benign 0.25
R7460:1300017J02Rik UTSW 9 103254648 missense probably benign 0.00
R7993:1300017J02Rik UTSW 9 103263133 missense probably benign
R8056:1300017J02Rik UTSW 9 103266224 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGCCAAGGGAGTATTCTTTATAG -3'
(R):5'- CTTGTGTTGCAGGCAGTCTCAG -3'

Sequencing Primer
(F):5'- GGGAGTATTCTTTATAGAACCAGGC -3'
(R):5'- GGCAGTCTCAGGGACAAACCTC -3'
Posted On2021-03-08