Mutagenetix > Incidental Mutation

Incidental Mutation 'R8686:Dnajc13'

662051

Institutional Source

Beutler Lab

Gene Symbol

Dnajc13

Ensembl Gene

ENSMUSG00000032560

Gene Name

DnaJ heat shock protein family (Hsp40) member C13

Synonyms

LOC382100, D030002L11Rik, Rme8

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.946) question?

Stock #

R8686 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

104151282-104262930 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 104170805 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 1804 (I1804V)

Ref Sequence

ENSEMBL: ENSMUSP00000139804 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035170] [ENSMUST00000186788]

AlphaFold

D4AFX7

Predicted Effect

probably benign
Transcript: ENSMUST00000035170
AA Change: I1799V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000035170
Gene: ENSMUSG00000032560
AA Change: I1799V

Domain	Start	End	E-Value	Type
low complexity region	706	719	N/A	INTRINSIC
low complexity region	832	843	N/A	INTRINSIC
low complexity region	913	926	N/A	INTRINSIC
Blast:ARM	927	963	6e-12	BLAST
Pfam:DUF4339	976	1020	1.5e-18	PFAM
Blast:ARM	1071	1110	5e-12	BLAST
DnaJ	1300	1358	5.69e-18	SMART
low complexity region	1417	1426	N/A	INTRINSIC
low complexity region	1813	1829	N/A	INTRINSIC
Blast:ARM	1843	1884	6e-8	BLAST
low complexity region	1968	1984	N/A	INTRINSIC
low complexity region	2006	2016	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000186788
AA Change: I1804V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000139804
Gene: ENSMUSG00000032560
AA Change: I1804V

Domain	Start	End	E-Value	Type
low complexity region	706	719	N/A	INTRINSIC
low complexity region	837	848	N/A	INTRINSIC
low complexity region	918	931	N/A	INTRINSIC
Blast:ARM	932	968	6e-12	BLAST
Pfam:DUF4339	980	1025	8.1e-14	PFAM
Blast:ARM	1076	1115	5e-12	BLAST
DnaJ	1305	1363	5.69e-18	SMART
low complexity region	1422	1431	N/A	INTRINSIC
low complexity region	1818	1834	N/A	INTRINSIC
Blast:ARM	1848	1889	6e-8	BLAST
low complexity region	1973	1989	N/A	INTRINSIC
low complexity region	2011	2021	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

100% (58/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Dnaj protein family whose members act as co-chaperones of a partner heat-shock protein by binding to the latter and stimulating ATP hydrolysis. The encoded protein associates with the heat-shock protein Hsc70 and plays a role in clathrin-mediated endocytosis. It may also be involved in post-endocytic transport mechanisms via its associations with other proteins, including the sorting nexin SNX1. Mutations in this gene are associated with Parkinson's disease. [provided by RefSeq, Jun 2016]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1300017J02Rik	C	T	9: 103,259,428	A525T	probably benign	Het
Adam25	A	G	8: 40,755,484	T596A	probably benign	Het
Adamts6	A	G	13: 104,313,699	I303V	probably damaging	Het
Alpl	A	T	4: 137,743,801	H341Q	probably damaging	Het
Cachd1	G	A	4: 100,988,128	R939H	probably damaging	Het
Ccdc114	A	G	7: 45,947,692	T456A	probably benign	Het
Cd22	G	A	7: 30,870,069	R541C	probably benign	Het
Cenpf	A	T	1: 189,659,604	M660K	probably benign	Het
Cmya5	A	T	13: 93,095,380	S1067T	possibly damaging	Het
Col5a2	C	T	1: 45,421,987	G250D	probably damaging	Het
Cylc2	C	T	4: 51,229,651	T331M	unknown	Het
Dgka	A	G	10: 128,733,093	M201T	probably benign	Het
Dym	T	A	18: 75,286,683	Y642N	probably damaging	Het
Efr3b	A	T	12: 4,000,886	D26E	probably damaging	Het
Emilin1	A	T	5: 30,917,696	K427M	possibly damaging	Het
Fam187b	T	C	7: 30,977,234	L56S	probably benign	Het
Fbxo18	C	T	2: 11,755,658	V694I	probably benign	Het
Fgd2	C	T	17: 29,379,023	T644I	probably benign	Het
G6pc	T	G	11: 101,374,707		probably null	Het
Gli2	A	G	1: 118,836,687	S1245P	probably benign	Het
Gm10696	T	C	3: 94,176,120	D128G	probably benign	Het
Gpr137b	T	C	13: 13,359,406	Y355C		Het
Ighv1-84	T	C	12: 115,980,904	D50G	probably benign	Het
Impdh1	C	A	6: 29,216,215		probably benign	Het
Irf4	A	T	13: 30,761,450	D393V	possibly damaging	Het
Kalrn	A	G	16: 34,360,935	L111P	probably damaging	Het
Lrch3	T	C	16: 32,981,853	V58A	possibly damaging	Het
Lrif1	C	T	3: 106,732,781	T394I	probably damaging	Het
Map4k1	A	G	7: 28,994,073	T434A	probably benign	Het
Mcur1	G	A	13: 43,541,717	T327M	probably damaging	Het
Mettl7b	A	T	10: 128,960,607	M111K	possibly damaging	Het
Myo9b	G	T	8: 71,334,322	S716I	probably benign	Het
Nol10	T	A	12: 17,369,771		probably benign	Het
Nos3	A	G	5: 24,368,843	T202A	possibly damaging	Het
Olfr128	T	C	17: 37,924,277	V237A	probably benign	Het
Olfr710	A	C	7: 106,944,698	M101R	probably benign	Het
Parp12	A	T	6: 39,117,922	S80T	probably benign	Het
Pde1a	C	T	2: 79,927,742	V50I	probably benign	Het
Pfkl	A	T	10: 77,997,522		probably null	Het
Phkg1	A	T	5: 129,866,215	Y207N	probably damaging	Het
Pik3r4	A	G	9: 105,658,529	T640A	possibly damaging	Het
Pip5k1c	C	A	10: 81,311,993	H411N	probably damaging	Het
Pla2g4e	A	G	2: 120,244,691	S73P	probably damaging	Het
Polr2b	T	C	5: 77,335,663	V662A	probably damaging	Het
Prss43	C	T	9: 110,829,426	R265C	possibly damaging	Het
Rap1b	A	T	10: 117,822,841	V29D	probably damaging	Het
Rraga	A	G	4: 86,576,811	E298G	probably damaging	Het
Rrp8	A	T	7: 105,733,574	I418N	probably damaging	Het
Siglecf	T	C	7: 43,355,606	V420A	probably benign	Het
Snx14	T	A	9: 88,415,693	N174I	probably damaging	Het
Speer4e	T	C	5: 14,934,115	N229S	probably benign	Het
Teddm3	A	G	16: 21,152,935	*295Q	probably null	Het
Tfap2c	A	G	2: 172,552,006	D245G	possibly damaging	Het
Tfap2d	A	G	1: 19,108,284	N191S	probably benign	Het
Unc80	A	G	1: 66,612,268	R1591G	possibly damaging	Het
Vmn1r116	T	C	7: 20,872,691	W146R	probably damaging	Het
Vps13b	C	G	15: 35,925,389	S3823R	probably damaging	Het
Wiz	T	A	17: 32,367,847	D163V	probably damaging	Het
Xylt1	G	C	7: 117,381,359	A61P	unknown	Het
Zfp521	A	C	18: 13,845,644	F571V	probably damaging	Het
Zfp664	T	A	5: 124,886,069	C176S	possibly damaging	Het
Zfyve26	T	C	12: 79,287,453	N264D	probably benign	Het

Other mutations in Dnajc13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00743:Dnajc13	APN	9	104162780	missense	probably benign	0.15
IGL00754:Dnajc13	APN	9	104174498	nonsense	probably null
IGL00914:Dnajc13	APN	9	104212882	missense	possibly damaging	0.90
IGL01014:Dnajc13	APN	9	104203218	missense	probably damaging	1.00
IGL01077:Dnajc13	APN	9	104231021	missense	probably benign	0.11
IGL01137:Dnajc13	APN	9	104160490	missense	probably benign
IGL01305:Dnajc13	APN	9	104230637	splice site	probably null
IGL01707:Dnajc13	APN	9	104228979	missense	probably damaging	1.00
IGL01781:Dnajc13	APN	9	104162359	missense	possibly damaging	0.82
IGL01868:Dnajc13	APN	9	104162745	missense	possibly damaging	0.83
IGL01950:Dnajc13	APN	9	104190432	missense	possibly damaging	0.85
IGL02102:Dnajc13	APN	9	104229009	missense	possibly damaging	0.78
IGL02350:Dnajc13	APN	9	104162359	missense	possibly damaging	0.82
IGL02357:Dnajc13	APN	9	104162359	missense	possibly damaging	0.82
IGL02470:Dnajc13	APN	9	104175747	missense	probably benign	0.17
IGL02888:Dnajc13	APN	9	104180062	splice site	probably benign
IGL03079:Dnajc13	APN	9	104212869	nonsense	probably null
IGL03179:Dnajc13	APN	9	104167435	missense	probably benign	0.42
IGL03293:Dnajc13	APN	9	104174426	missense	possibly damaging	0.64
impressario	UTSW	9	104213886	missense	probably benign	0.12
Kaiser	UTSW	9	104214188	missense	probably damaging	1.00
BB008:Dnajc13	UTSW	9	104218564	missense	probably benign	0.02
BB018:Dnajc13	UTSW	9	104218564	missense	probably benign	0.02
PIT4142001:Dnajc13	UTSW	9	104238473	missense	probably damaging	0.96
R0323:Dnajc13	UTSW	9	104156892	missense	probably damaging	1.00
R0361:Dnajc13	UTSW	9	104167059	missense	probably benign	0.18
R0480:Dnajc13	UTSW	9	104200509	missense	probably damaging	0.98
R0558:Dnajc13	UTSW	9	104201952	critical splice acceptor site	probably null
R0707:Dnajc13	UTSW	9	104172582	missense	probably benign	0.12
R0831:Dnajc13	UTSW	9	104172612	missense	probably damaging	1.00
R1234:Dnajc13	UTSW	9	104214157	missense	possibly damaging	0.64
R1433:Dnajc13	UTSW	9	104180121	missense	probably damaging	1.00
R1463:Dnajc13	UTSW	9	104178940	missense	probably damaging	1.00
R1464:Dnajc13	UTSW	9	104214167	missense	probably benign	0.10
R1464:Dnajc13	UTSW	9	104214167	missense	probably benign	0.10
R1489:Dnajc13	UTSW	9	104231035	missense	possibly damaging	0.94
R1575:Dnajc13	UTSW	9	104156838	missense	probably benign	0.29
R1750:Dnajc13	UTSW	9	104221477	missense	probably damaging	0.98
R1903:Dnajc13	UTSW	9	104228937	missense	probably damaging	0.98
R2066:Dnajc13	UTSW	9	104221441	missense	probably benign	0.01
R2206:Dnajc13	UTSW	9	104203518	missense	probably damaging	1.00
R3160:Dnajc13	UTSW	9	104219898	missense	possibly damaging	0.57
R3162:Dnajc13	UTSW	9	104219898	missense	possibly damaging	0.57
R4158:Dnajc13	UTSW	9	104190442	missense	probably damaging	0.96
R4460:Dnajc13	UTSW	9	104181063	missense	probably damaging	0.96
R4537:Dnajc13	UTSW	9	104186805	intron	probably benign
R4538:Dnajc13	UTSW	9	104186805	intron	probably benign
R4631:Dnajc13	UTSW	9	104190417	missense	probably damaging	1.00
R4662:Dnajc13	UTSW	9	104207758	missense	probably damaging	1.00
R4722:Dnajc13	UTSW	9	104213818	missense	probably benign
R4731:Dnajc13	UTSW	9	104186805	intron	probably benign
R4732:Dnajc13	UTSW	9	104186805	intron	probably benign
R4758:Dnajc13	UTSW	9	104172574	missense	probably damaging	1.00
R4801:Dnajc13	UTSW	9	104175727	missense	probably benign	0.16
R4802:Dnajc13	UTSW	9	104175727	missense	probably benign	0.16
R4928:Dnajc13	UTSW	9	104233638	missense	possibly damaging	0.93
R4944:Dnajc13	UTSW	9	104167387	unclassified	probably benign
R4979:Dnajc13	UTSW	9	104186723	missense	probably damaging	1.00
R5177:Dnajc13	UTSW	9	104230986	missense	probably benign	0.39
R5190:Dnajc13	UTSW	9	104174525	missense	probably benign	0.00
R5256:Dnajc13	UTSW	9	104203329	missense	possibly damaging	0.86
R5452:Dnajc13	UTSW	9	104192114	missense	probably benign	0.01
R5657:Dnajc13	UTSW	9	104228537	missense	probably damaging	1.00
R5752:Dnajc13	UTSW	9	104192774	splice site	probably null
R5789:Dnajc13	UTSW	9	104214188	missense	probably damaging	1.00
R5837:Dnajc13	UTSW	9	104176666	missense	possibly damaging	0.88
R5846:Dnajc13	UTSW	9	104190385	missense	probably damaging	0.99
R5982:Dnajc13	UTSW	9	104184615	missense	possibly damaging	0.77
R6189:Dnajc13	UTSW	9	104213886	missense	probably benign	0.12
R6355:Dnajc13	UTSW	9	104203270	missense	probably damaging	0.99
R6483:Dnajc13	UTSW	9	104207804	missense	probably damaging	0.96
R6613:Dnajc13	UTSW	9	104213877	missense	probably benign	0.07
R6962:Dnajc13	UTSW	9	104181009	missense	probably benign	0.02
R7048:Dnajc13	UTSW	9	104203414	critical splice donor site	probably null
R7101:Dnajc13	UTSW	9	104165022	missense	possibly damaging	0.92
R7304:Dnajc13	UTSW	9	104238514	missense	probably benign	0.00
R7353:Dnajc13	UTSW	9	104230031	missense	possibly damaging	0.89
R7366:Dnajc13	UTSW	9	104184706	missense	probably benign	0.43
R7528:Dnajc13	UTSW	9	104178965	missense	possibly damaging	0.65
R7635:Dnajc13	UTSW	9	104162367	missense	probably benign
R7673:Dnajc13	UTSW	9	104233692	missense	probably benign	0.09
R7856:Dnajc13	UTSW	9	104167485	missense	possibly damaging	0.83
R7931:Dnajc13	UTSW	9	104218564	missense	probably benign	0.02
R7995:Dnajc13	UTSW	9	104174363	missense	probably damaging	1.00
R8319:Dnajc13	UTSW	9	104190391	missense	probably benign	0.00
R8354:Dnajc13	UTSW	9	104217728	missense	probably damaging	1.00
R8680:Dnajc13	UTSW	9	104180139	missense	probably benign
R8707:Dnajc13	UTSW	9	104192648	missense	probably damaging	0.96
R8847:Dnajc13	UTSW	9	104180161	nonsense	probably null
R8868:Dnajc13	UTSW	9	104165788	missense	probably benign	0.13
R8986:Dnajc13	UTSW	9	104180131	missense	probably damaging	1.00
R9139:Dnajc13	UTSW	9	104207840	missense	probably benign	0.02
R9334:Dnajc13	UTSW	9	104174460	missense	probably benign	0.00
R9353:Dnajc13	UTSW	9	104190372	missense	probably benign	0.31
R9470:Dnajc13	UTSW	9	104230720	missense	probably benign	0.01
R9528:Dnajc13	UTSW	9	104237705	missense	probably benign
R9578:Dnajc13	UTSW	9	104238527	missense	probably benign	0.04
X0017:Dnajc13	UTSW	9	104238478	missense	possibly damaging	0.90
X0028:Dnajc13	UTSW	9	104165018	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCACGTGCTCTTATTCACAC -3'
(R):5'- ATCAACGTCAGACAGAAGGC -3'

Sequencing Primer
(F):5'- GGGAAACAGCATAATTTCATTCAC -3'
(R):5'- TCAACGTCAGACAGAAGGCTTCTTAG -3'

Posted On

2021-03-08