Mutagenetix > Incidental Mutation

Incidental Mutation 'R8686:Dnajc13'

662051

Institutional Source

Beutler Lab

Gene Symbol

Dnajc13

Ensembl Gene

ENSMUSG00000032560

Gene Name

DnaJ heat shock protein family (Hsp40) member C13

Synonyms

LOC382100, D030002L11Rik, Rme8

MMRRC Submission

068541-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.934) question?

Stock #

R8686 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

104151282-104262930 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 104170805 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 1804 (I1804V)

Ref Sequence

ENSEMBL: ENSMUSP00000139804 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035170] [ENSMUST00000186788]

AlphaFold

D4AFX7

Predicted Effect

probably benign
Transcript: ENSMUST00000035170
AA Change: I1799V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000035170
Gene: ENSMUSG00000032560
AA Change: I1799V

Domain	Start	End	E-Value	Type
low complexity region	706	719	N/A	INTRINSIC
low complexity region	832	843	N/A	INTRINSIC
low complexity region	913	926	N/A	INTRINSIC
Blast:ARM	927	963	6e-12	BLAST
Pfam:DUF4339	976	1020	1.5e-18	PFAM
Blast:ARM	1071	1110	5e-12	BLAST
DnaJ	1300	1358	5.69e-18	SMART
low complexity region	1417	1426	N/A	INTRINSIC
low complexity region	1813	1829	N/A	INTRINSIC
Blast:ARM	1843	1884	6e-8	BLAST
low complexity region	1968	1984	N/A	INTRINSIC
low complexity region	2006	2016	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000186788
AA Change: I1804V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000139804
Gene: ENSMUSG00000032560
AA Change: I1804V

Domain	Start	End	E-Value	Type
low complexity region	706	719	N/A	INTRINSIC
low complexity region	837	848	N/A	INTRINSIC
low complexity region	918	931	N/A	INTRINSIC
Blast:ARM	932	968	6e-12	BLAST
Pfam:DUF4339	980	1025	8.1e-14	PFAM
Blast:ARM	1076	1115	5e-12	BLAST
DnaJ	1305	1363	5.69e-18	SMART
low complexity region	1422	1431	N/A	INTRINSIC
low complexity region	1818	1834	N/A	INTRINSIC
Blast:ARM	1848	1889	6e-8	BLAST
low complexity region	1973	1989	N/A	INTRINSIC
low complexity region	2011	2021	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

100% (58/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Dnaj protein family whose members act as co-chaperones of a partner heat-shock protein by binding to the latter and stimulating ATP hydrolysis. The encoded protein associates with the heat-shock protein Hsc70 and plays a role in clathrin-mediated endocytosis. It may also be involved in post-endocytic transport mechanisms via its associations with other proteins, including the sorting nexin SNX1. Mutations in this gene are associated with Parkinson's disease. [provided by RefSeq, Jun 2016]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1300017J02Rik	C	T	9: 103,259,428	A525T	probably benign	Het
Adam25	A	G	8: 40,755,484	T596A	probably benign	Het
Adamts6	A	G	13: 104,313,699	I303V	probably damaging	Het
Alpl	A	T	4: 137,743,801	H341Q	probably damaging	Het
Cachd1	G	A	4: 100,988,128	R939H	probably damaging	Het
Ccdc114	A	G	7: 45,947,692	T456A	probably benign	Het
Cd22	G	A	7: 30,870,069	R541C	probably benign	Het
Cenpf	A	T	1: 189,659,604	M660K	probably benign	Het
Cmya5	A	T	13: 93,095,380	S1067T	possibly damaging	Het
Col5a2	C	T	1: 45,421,987	G250D	probably damaging	Het
Cylc2	C	T	4: 51,229,651	T331M	unknown	Het
Dgka	A	G	10: 128,733,093	M201T	probably benign	Het
Dym	T	A	18: 75,286,683	Y642N	probably damaging	Het
Efr3b	A	T	12: 4,000,886	D26E	probably damaging	Het
Emilin1	A	T	5: 30,917,696	K427M	possibly damaging	Het
Fam187b	T	C	7: 30,977,234	L56S	probably benign	Het
Fbxo18	C	T	2: 11,755,658	V694I	probably benign	Het
Fgd2	C	T	17: 29,379,023	T644I	probably benign	Het
G6pc	T	G	11: 101,374,707		probably null	Het
Gli2	A	G	1: 118,836,687	S1245P	probably benign	Het
Gm10696	T	C	3: 94,176,120	D128G	probably benign	Het
Gpr137b	T	C	13: 13,359,406	Y355C		Het
Ighv1-84	T	C	12: 115,980,904	D50G	probably benign	Het
Impdh1	C	A	6: 29,216,215		probably benign	Het
Irf4	A	T	13: 30,761,450	D393V	possibly damaging	Het
Kalrn	A	G	16: 34,360,935	L111P	probably damaging	Het
Lrch3	T	C	16: 32,981,853	V58A	possibly damaging	Het
Lrif1	C	T	3: 106,732,781	T394I	probably damaging	Het
Map4k1	A	G	7: 28,994,073	T434A	probably benign	Het
Mcur1	G	A	13: 43,541,717	T327M	probably damaging	Het
Mettl7b	A	T	10: 128,960,607	M111K	possibly damaging	Het
Myo9b	G	T	8: 71,334,322	S716I	probably benign	Het
Nol10	T	A	12: 17,369,771		probably benign	Het
Nos3	A	G	5: 24,368,843	T202A	possibly damaging	Het
Olfr128	T	C	17: 37,924,277	V237A	probably benign	Het
Olfr710	A	C	7: 106,944,698	M101R	probably benign	Het
Parp12	A	T	6: 39,117,922	S80T	probably benign	Het
Pde1a	C	T	2: 79,927,742	V50I	probably benign	Het
Pfkl	A	T	10: 77,997,522		probably null	Het
Phkg1	A	T	5: 129,866,215	Y207N	probably damaging	Het
Pik3r4	A	G	9: 105,658,529	T640A	possibly damaging	Het
Pip5k1c	C	A	10: 81,311,993	H411N	probably damaging	Het
Pla2g4e	A	G	2: 120,244,691	S73P	probably damaging	Het
Polr2b	T	C	5: 77,335,663	V662A	probably damaging	Het
Prss43	C	T	9: 110,829,426	R265C	possibly damaging	Het
Rap1b	A	T	10: 117,822,841	V29D	probably damaging	Het
Rraga	A	G	4: 86,576,811	E298G	probably damaging	Het
Rrp8	A	T	7: 105,733,574	I418N	probably damaging	Het
Siglecf	T	C	7: 43,355,606	V420A	probably benign	Het
Snx14	T	A	9: 88,415,693	N174I	probably damaging	Het
Speer4e	T	C	5: 14,934,115	N229S	probably benign	Het
Teddm3	A	G	16: 21,152,935	*295Q	probably null	Het
Tfap2c	A	G	2: 172,552,006	D245G	possibly damaging	Het
Tfap2d	A	G	1: 19,108,284	N191S	probably benign	Het
Unc80	A	G	1: 66,612,268	R1591G	possibly damaging	Het
Vmn1r116	T	C	7: 20,872,691	W146R	probably damaging	Het
Vps13b	C	G	15: 35,925,389	S3823R	probably damaging	Het
Wiz	T	A	17: 32,367,847	D163V	probably damaging	Het
Xylt1	G	C	7: 117,381,359	A61P	unknown	Het
Zfp521	A	C	18: 13,845,644	F571V	probably damaging	Het
Zfp664	T	A	5: 124,886,069	C176S	possibly damaging	Het
Zfyve26	T	C	12: 79,287,453	N264D	probably benign	Het

Other mutations in Dnajc13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00743:Dnajc13	APN	9	104162780	missense	probably benign	0.15
IGL00754:Dnajc13	APN	9	104174498	nonsense	probably null
IGL00914:Dnajc13	APN	9	104212882	missense	possibly damaging	0.90
IGL01014:Dnajc13	APN	9	104203218	missense	probably damaging	1.00
IGL01077:Dnajc13	APN	9	104231021	missense	probably benign	0.11
IGL01137:Dnajc13	APN	9	104160490	missense	probably benign
IGL01305:Dnajc13	APN	9	104230637	splice site	probably null
IGL01707:Dnajc13	APN	9	104228979	missense	probably damaging	1.00
IGL01781:Dnajc13	APN	9	104162359	missense	possibly damaging	0.82
IGL01868:Dnajc13	APN	9	104162745	missense	possibly damaging	0.83
IGL01950:Dnajc13	APN	9	104190432	missense	possibly damaging	0.85
IGL02102:Dnajc13	APN	9	104229009	missense	possibly damaging	0.78
IGL02350:Dnajc13	APN	9	104162359	missense	possibly damaging	0.82
IGL02357:Dnajc13	APN	9	104162359	missense	possibly damaging	0.82
IGL02470:Dnajc13	APN	9	104175747	missense	probably benign	0.17
IGL02888:Dnajc13	APN	9	104180062	splice site	probably benign
IGL03079:Dnajc13	APN	9	104212869	nonsense	probably null
IGL03179:Dnajc13	APN	9	104167435	missense	probably benign	0.42
IGL03293:Dnajc13	APN	9	104174426	missense	possibly damaging	0.64
impressario	UTSW	9	104213886	missense	probably benign	0.12
Kaiser	UTSW	9	104214188	missense	probably damaging	1.00
BB008:Dnajc13	UTSW	9	104218564	missense	probably benign	0.02
BB018:Dnajc13	UTSW	9	104218564	missense	probably benign	0.02
PIT4142001:Dnajc13	UTSW	9	104238473	missense	probably damaging	0.96
R0323:Dnajc13	UTSW	9	104156892	missense	probably damaging	1.00
R0361:Dnajc13	UTSW	9	104167059	missense	probably benign	0.18
R0480:Dnajc13	UTSW	9	104200509	missense	probably damaging	0.98
R0558:Dnajc13	UTSW	9	104201952	critical splice acceptor site	probably null
R0707:Dnajc13	UTSW	9	104172582	missense	probably benign	0.12
R0831:Dnajc13	UTSW	9	104172612	missense	probably damaging	1.00
R1234:Dnajc13	UTSW	9	104214157	missense	possibly damaging	0.64
R1433:Dnajc13	UTSW	9	104180121	missense	probably damaging	1.00
R1463:Dnajc13	UTSW	9	104178940	missense	probably damaging	1.00
R1464:Dnajc13	UTSW	9	104214167	missense	probably benign	0.10
R1464:Dnajc13	UTSW	9	104214167	missense	probably benign	0.10
R1489:Dnajc13	UTSW	9	104231035	missense	possibly damaging	0.94
R1575:Dnajc13	UTSW	9	104156838	missense	probably benign	0.29
R1750:Dnajc13	UTSW	9	104221477	missense	probably damaging	0.98
R1903:Dnajc13	UTSW	9	104228937	missense	probably damaging	0.98
R2066:Dnajc13	UTSW	9	104221441	missense	probably benign	0.01
R2206:Dnajc13	UTSW	9	104203518	missense	probably damaging	1.00
R3160:Dnajc13	UTSW	9	104219898	missense	possibly damaging	0.57
R3162:Dnajc13	UTSW	9	104219898	missense	possibly damaging	0.57
R4158:Dnajc13	UTSW	9	104190442	missense	probably damaging	0.96
R4460:Dnajc13	UTSW	9	104181063	missense	probably damaging	0.96
R4537:Dnajc13	UTSW	9	104186805	intron	probably benign
R4538:Dnajc13	UTSW	9	104186805	intron	probably benign
R4631:Dnajc13	UTSW	9	104190417	missense	probably damaging	1.00
R4662:Dnajc13	UTSW	9	104207758	missense	probably damaging	1.00
R4722:Dnajc13	UTSW	9	104213818	missense	probably benign
R4731:Dnajc13	UTSW	9	104186805	intron	probably benign
R4732:Dnajc13	UTSW	9	104186805	intron	probably benign
R4758:Dnajc13	UTSW	9	104172574	missense	probably damaging	1.00
R4801:Dnajc13	UTSW	9	104175727	missense	probably benign	0.16
R4802:Dnajc13	UTSW	9	104175727	missense	probably benign	0.16
R4928:Dnajc13	UTSW	9	104233638	missense	possibly damaging	0.93
R4944:Dnajc13	UTSW	9	104167387	unclassified	probably benign
R4979:Dnajc13	UTSW	9	104186723	missense	probably damaging	1.00
R5177:Dnajc13	UTSW	9	104230986	missense	probably benign	0.39
R5190:Dnajc13	UTSW	9	104174525	missense	probably benign	0.00
R5256:Dnajc13	UTSW	9	104203329	missense	possibly damaging	0.86
R5452:Dnajc13	UTSW	9	104192114	missense	probably benign	0.01
R5657:Dnajc13	UTSW	9	104228537	missense	probably damaging	1.00
R5752:Dnajc13	UTSW	9	104192774	splice site	probably null
R5789:Dnajc13	UTSW	9	104214188	missense	probably damaging	1.00
R5837:Dnajc13	UTSW	9	104176666	missense	possibly damaging	0.88
R5846:Dnajc13	UTSW	9	104190385	missense	probably damaging	0.99
R5982:Dnajc13	UTSW	9	104184615	missense	possibly damaging	0.77
R6189:Dnajc13	UTSW	9	104213886	missense	probably benign	0.12
R6355:Dnajc13	UTSW	9	104203270	missense	probably damaging	0.99
R6483:Dnajc13	UTSW	9	104207804	missense	probably damaging	0.96
R6613:Dnajc13	UTSW	9	104213877	missense	probably benign	0.07
R6962:Dnajc13	UTSW	9	104181009	missense	probably benign	0.02
R7048:Dnajc13	UTSW	9	104203414	critical splice donor site	probably null
R7101:Dnajc13	UTSW	9	104165022	missense	possibly damaging	0.92
R7304:Dnajc13	UTSW	9	104238514	missense	probably benign	0.00
R7353:Dnajc13	UTSW	9	104230031	missense	possibly damaging	0.89
R7366:Dnajc13	UTSW	9	104184706	missense	probably benign	0.43
R7528:Dnajc13	UTSW	9	104178965	missense	possibly damaging	0.65
R7635:Dnajc13	UTSW	9	104162367	missense	probably benign
R7673:Dnajc13	UTSW	9	104233692	missense	probably benign	0.09
R7856:Dnajc13	UTSW	9	104167485	missense	possibly damaging	0.83
R7931:Dnajc13	UTSW	9	104218564	missense	probably benign	0.02
R7995:Dnajc13	UTSW	9	104174363	missense	probably damaging	1.00
R8319:Dnajc13	UTSW	9	104190391	missense	probably benign	0.00
R8354:Dnajc13	UTSW	9	104217728	missense	probably damaging	1.00
R8680:Dnajc13	UTSW	9	104180139	missense	probably benign
R8707:Dnajc13	UTSW	9	104192648	missense	probably damaging	0.96
R8847:Dnajc13	UTSW	9	104180161	nonsense	probably null
R8868:Dnajc13	UTSW	9	104165788	missense	probably benign	0.13
R8986:Dnajc13	UTSW	9	104180131	missense	probably damaging	1.00
R9139:Dnajc13	UTSW	9	104207840	missense	probably benign	0.02
R9334:Dnajc13	UTSW	9	104174460	missense	probably benign	0.00
R9353:Dnajc13	UTSW	9	104190372	missense	probably benign	0.31
R9470:Dnajc13	UTSW	9	104230720	missense	probably benign	0.01
R9528:Dnajc13	UTSW	9	104237705	missense	probably benign
R9578:Dnajc13	UTSW	9	104238527	missense	probably benign	0.04
R9658:Dnajc13	UTSW	9	104238529	missense	probably benign	0.11
R9691:Dnajc13	UTSW	9	104165012	missense	probably damaging	1.00
X0017:Dnajc13	UTSW	9	104238478	missense	possibly damaging	0.90
X0028:Dnajc13	UTSW	9	104165018	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCACGTGCTCTTATTCACAC -3'
(R):5'- ATCAACGTCAGACAGAAGGC -3'

Sequencing Primer
(F):5'- GGGAAACAGCATAATTTCATTCAC -3'
(R):5'- TCAACGTCAGACAGAAGGCTTCTTAG -3'

Posted On

2021-03-08