Incidental Mutation 'R8686:Prss43'
ID 662053
Institutional Source Beutler Lab
Gene Symbol Prss43
Ensembl Gene ENSMUSG00000058398
Gene Name protease, serine 43
Synonyms LOC272643, Tessp3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R8686 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 110826690-110831839 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 110829426 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 265 (R265C)
Ref Sequence ENSEMBL: ENSMUSP00000076752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077549] [ENSMUST00000141089]
AlphaFold Q76HL1
Predicted Effect possibly damaging
Transcript: ENSMUST00000077549
AA Change: R265C

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000076752
Gene: ENSMUSG00000058398
AA Change: R265C

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 41 49 N/A INTRINSIC
Tryp_SPc 115 350 5.86e-58 SMART
transmembrane domain 362 381 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141089
SMART Domains Protein: ENSMUSP00000117039
Gene: ENSMUSG00000032493

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Trypsin 112 144 1.3e-9 PFAM
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik C T 9: 103,259,428 A525T probably benign Het
Adam25 A G 8: 40,755,484 T596A probably benign Het
Adamts6 A G 13: 104,313,699 I303V probably damaging Het
Alpl A T 4: 137,743,801 H341Q probably damaging Het
Cachd1 G A 4: 100,988,128 R939H probably damaging Het
Ccdc114 A G 7: 45,947,692 T456A probably benign Het
Cd22 G A 7: 30,870,069 R541C probably benign Het
Cenpf A T 1: 189,659,604 M660K probably benign Het
Cmya5 A T 13: 93,095,380 S1067T possibly damaging Het
Col5a2 C T 1: 45,421,987 G250D probably damaging Het
Cylc2 C T 4: 51,229,651 T331M unknown Het
Dgka A G 10: 128,733,093 M201T probably benign Het
Dnajc13 T C 9: 104,170,805 I1804V probably benign Het
Dym T A 18: 75,286,683 Y642N probably damaging Het
Efr3b A T 12: 4,000,886 D26E probably damaging Het
Emilin1 A T 5: 30,917,696 K427M possibly damaging Het
Fam187b T C 7: 30,977,234 L56S probably benign Het
Fbxo18 C T 2: 11,755,658 V694I probably benign Het
Fgd2 C T 17: 29,379,023 T644I probably benign Het
G6pc T G 11: 101,374,707 probably null Het
Gli2 A G 1: 118,836,687 S1245P probably benign Het
Gm10696 T C 3: 94,176,120 D128G probably benign Het
Gpr137b T C 13: 13,359,406 Y355C Het
Ighv1-84 T C 12: 115,980,904 D50G probably benign Het
Impdh1 C A 6: 29,216,215 probably benign Het
Irf4 A T 13: 30,761,450 D393V possibly damaging Het
Kalrn A G 16: 34,360,935 L111P probably damaging Het
Lrch3 T C 16: 32,981,853 V58A possibly damaging Het
Lrif1 C T 3: 106,732,781 T394I probably damaging Het
Map4k1 A G 7: 28,994,073 T434A probably benign Het
Mcur1 G A 13: 43,541,717 T327M probably damaging Het
Mettl7b A T 10: 128,960,607 M111K possibly damaging Het
Myo9b G T 8: 71,334,322 S716I probably benign Het
Nol10 T A 12: 17,369,771 probably benign Het
Nos3 A G 5: 24,368,843 T202A possibly damaging Het
Olfr128 T C 17: 37,924,277 V237A probably benign Het
Olfr710 A C 7: 106,944,698 M101R probably benign Het
Parp12 A T 6: 39,117,922 S80T probably benign Het
Pde1a C T 2: 79,927,742 V50I probably benign Het
Pfkl A T 10: 77,997,522 probably null Het
Phkg1 A T 5: 129,866,215 Y207N probably damaging Het
Pik3r4 A G 9: 105,658,529 T640A possibly damaging Het
Pip5k1c C A 10: 81,311,993 H411N probably damaging Het
Pla2g4e A G 2: 120,244,691 S73P probably damaging Het
Polr2b T C 5: 77,335,663 V662A probably damaging Het
Rap1b A T 10: 117,822,841 V29D probably damaging Het
Rraga A G 4: 86,576,811 E298G probably damaging Het
Rrp8 A T 7: 105,733,574 I418N probably damaging Het
Siglecf T C 7: 43,355,606 V420A probably benign Het
Snx14 T A 9: 88,415,693 N174I probably damaging Het
Speer4e T C 5: 14,934,115 N229S probably benign Het
Teddm3 A G 16: 21,152,935 *295Q probably null Het
Tfap2c A G 2: 172,552,006 D245G possibly damaging Het
Tfap2d A G 1: 19,108,284 N191S probably benign Het
Unc80 A G 1: 66,612,268 R1591G possibly damaging Het
Vmn1r116 T C 7: 20,872,691 W146R probably damaging Het
Vps13b C G 15: 35,925,389 S3823R probably damaging Het
Wiz T A 17: 32,367,847 D163V probably damaging Het
Xylt1 G C 7: 117,381,359 A61P unknown Het
Zfp521 A C 18: 13,845,644 F571V probably damaging Het
Zfp664 T A 5: 124,886,069 C176S possibly damaging Het
Zfyve26 T C 12: 79,287,453 N264D probably benign Het
Other mutations in Prss43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Prss43 APN 9 110829470 missense probably benign 0.02
IGL01636:Prss43 APN 9 110827437 missense possibly damaging 0.75
IGL03046:Prss43 UTSW 9 110830981 missense probably benign 0.01
PIT4576001:Prss43 UTSW 9 110827887 missense probably damaging 1.00
R0020:Prss43 UTSW 9 110828512 unclassified probably benign
R0278:Prss43 UTSW 9 110827362 missense probably benign 0.07
R0883:Prss43 UTSW 9 110829508 missense probably damaging 1.00
R1384:Prss43 UTSW 9 110827442 missense probably benign 0.10
R2212:Prss43 UTSW 9 110829464 missense probably damaging 1.00
R3412:Prss43 UTSW 9 110829464 missense probably damaging 1.00
R3808:Prss43 UTSW 9 110827772 missense probably damaging 1.00
R4202:Prss43 UTSW 9 110827461 missense probably benign 0.08
R4530:Prss43 UTSW 9 110829504 missense probably benign 0.38
R4752:Prss43 UTSW 9 110827768 missense possibly damaging 0.47
R5009:Prss43 UTSW 9 110827421 missense possibly damaging 0.50
R6920:Prss43 UTSW 9 110828612 missense probably benign 0.04
R7271:Prss43 UTSW 9 110828603 missense probably damaging 1.00
R7406:Prss43 UTSW 9 110828696 missense probably damaging 1.00
R7758:Prss43 UTSW 9 110829391 missense possibly damaging 0.91
R8257:Prss43 UTSW 9 110830812 missense possibly damaging 0.95
R8885:Prss43 UTSW 9 110830978 missense probably damaging 1.00
R9217:Prss43 UTSW 9 110827496 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- TGTCATTTTCCAGCTGGCAAG -3'
(R):5'- AGGTGGCAGATAACTCAAACC -3'

Sequencing Primer
(F):5'- CCAGCTGGCAAGACTTTTTC -3'
(R):5'- CCGCAGATCATCCCTTTA -3'
Posted On 2021-03-08