Incidental Mutation 'R8686:Pip5k1c'
ID 662055
Institutional Source Beutler Lab
Gene Symbol Pip5k1c
Ensembl Gene ENSMUSG00000034902
Gene Name phosphatidylinositol-4-phosphate 5-kinase, type 1 gamma
Synonyms PIP5KIgamma
MMRRC Submission 068541-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8686 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 81128797-81155807 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 81147827 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Asparagine at position 411 (H411N)
Ref Sequence ENSEMBL: ENSMUSP00000038225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045469] [ENSMUST00000105327] [ENSMUST00000160291] [ENSMUST00000161719] [ENSMUST00000161854] [ENSMUST00000161869] [ENSMUST00000163075]
AlphaFold O70161
Predicted Effect probably damaging
Transcript: ENSMUST00000045469
AA Change: H411N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038225
Gene: ENSMUSG00000034902
AA Change: H411N

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 69 78 N/A INTRINSIC
PIPKc 103 444 2.72e-164 SMART
low complexity region 518 534 N/A INTRINSIC
low complexity region 575 591 N/A INTRINSIC
low complexity region 601 628 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105327
AA Change: H411N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000100964
Gene: ENSMUSG00000034902
AA Change: H411N

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 69 78 N/A INTRINSIC
PIPKc 103 444 2.72e-164 SMART
low complexity region 518 534 N/A INTRINSIC
low complexity region 575 591 N/A INTRINSIC
low complexity region 601 628 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160291
SMART Domains Protein: ENSMUSP00000125645
Gene: ENSMUSG00000034902

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161586
SMART Domains Protein: ENSMUSP00000124612
Gene: ENSMUSG00000034902

DomainStartEndE-ValueType
low complexity region 28 44 N/A INTRINSIC
low complexity region 54 81 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000161719
AA Change: H101N

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125461
Gene: ENSMUSG00000034902
AA Change: H101N

DomainStartEndE-ValueType
Pfam:PIP5K 1 133 1.4e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161854
SMART Domains Protein: ENSMUSP00000124004
Gene: ENSMUSG00000034902

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161869
SMART Domains Protein: ENSMUSP00000124235
Gene: ENSMUSG00000034902

DomainStartEndE-ValueType
low complexity region 7 36 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163075
AA Change: H411N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124155
Gene: ENSMUSG00000034902
AA Change: H411N

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 69 78 N/A INTRINSIC
PIPKc 103 444 2.72e-164 SMART
low complexity region 518 534 N/A INTRINSIC
low complexity region 575 591 N/A INTRINSIC
low complexity region 601 628 N/A INTRINSIC
Meta Mutation Damage Score 0.5076 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a type I phosphatidylinositol 4-phosphate 5-kinase. The encoded protein catalyzes phosphorylation of phosphatidylinositol 4-phosphate, producing phosphatidylinositol 4,5-bisphosphate. This enzyme is found at synapses and has been found to play roles in endocytosis and cell migration. Mutations at this locus have been associated with lethal congenital contractural syndrome. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Sep 2010]
PHENOTYPE: Mutations in this locus cause variable phenotypes. One allele shows embryonic lethality, abnormal cardiovascular and neuronal development and impaired integrity of the megakaryocyte membrane cytoskeleton. Another allele exhibits neonatal lethality, synaptic transmission and plasticity defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 A G 8: 41,208,521 (GRCm39) T596A probably benign Het
Adamts6 A G 13: 104,450,207 (GRCm39) I303V probably damaging Het
Alpl A T 4: 137,471,112 (GRCm39) H341Q probably damaging Het
Cachd1 G A 4: 100,845,325 (GRCm39) R939H probably damaging Het
Cd22 G A 7: 30,569,494 (GRCm39) R541C probably benign Het
Cenpf A T 1: 189,391,801 (GRCm39) M660K probably benign Het
Cmya5 A T 13: 93,231,888 (GRCm39) S1067T possibly damaging Het
Col5a2 C T 1: 45,461,147 (GRCm39) G250D probably damaging Het
Cylc2 C T 4: 51,229,651 (GRCm39) T331M unknown Het
Dgka A G 10: 128,568,962 (GRCm39) M201T probably benign Het
Dnajc13 T C 9: 104,048,004 (GRCm39) I1804V probably benign Het
Dym T A 18: 75,419,754 (GRCm39) Y642N probably damaging Het
Efr3b A T 12: 4,050,886 (GRCm39) D26E probably damaging Het
Emilin1 A T 5: 31,075,040 (GRCm39) K427M possibly damaging Het
Fam187b T C 7: 30,676,659 (GRCm39) L56S probably benign Het
Fbh1 C T 2: 11,760,469 (GRCm39) V694I probably benign Het
Fgd2 C T 17: 29,597,997 (GRCm39) T644I probably benign Het
G6pc1 T G 11: 101,265,533 (GRCm39) probably null Het
Gli2 A G 1: 118,764,417 (GRCm39) S1245P probably benign Het
Gpr137b T C 13: 13,533,991 (GRCm39) Y355C Het
Ighv1-84 T C 12: 115,944,524 (GRCm39) D50G probably benign Het
Impdh1 C A 6: 29,216,214 (GRCm39) probably benign Het
Inhca C T 9: 103,136,627 (GRCm39) A525T probably benign Het
Irf4 A T 13: 30,945,433 (GRCm39) D393V possibly damaging Het
Kalrn A G 16: 34,181,305 (GRCm39) L111P probably damaging Het
Lrch3 T C 16: 32,802,223 (GRCm39) V58A possibly damaging Het
Lrif1 C T 3: 106,640,097 (GRCm39) T394I probably damaging Het
Map4k1 A G 7: 28,693,498 (GRCm39) T434A probably benign Het
Mcur1 G A 13: 43,695,193 (GRCm39) T327M probably damaging Het
Myo9b G T 8: 71,786,966 (GRCm39) S716I probably benign Het
Nol10 T A 12: 17,419,772 (GRCm39) probably benign Het
Nos3 A G 5: 24,573,841 (GRCm39) T202A possibly damaging Het
Odad1 A G 7: 45,597,116 (GRCm39) T456A probably benign Het
Or14j7 T C 17: 38,235,168 (GRCm39) V237A probably benign Het
Or2d4 A C 7: 106,543,905 (GRCm39) M101R probably benign Het
Parp12 A T 6: 39,094,856 (GRCm39) S80T probably benign Het
Pde1a C T 2: 79,758,086 (GRCm39) V50I probably benign Het
Pfkl A T 10: 77,833,356 (GRCm39) probably null Het
Phkg1 A T 5: 129,895,056 (GRCm39) Y207N probably damaging Het
Pik3r4 A G 9: 105,535,728 (GRCm39) T640A possibly damaging Het
Pla2g4e A G 2: 120,075,172 (GRCm39) S73P probably damaging Het
Polr2b T C 5: 77,483,510 (GRCm39) V662A probably damaging Het
Prss43 C T 9: 110,658,494 (GRCm39) R265C possibly damaging Het
Rap1b A T 10: 117,658,746 (GRCm39) V29D probably damaging Het
Rraga A G 4: 86,495,048 (GRCm39) E298G probably damaging Het
Rrp8 A T 7: 105,382,781 (GRCm39) I418N probably damaging Het
Siglecf T C 7: 43,005,030 (GRCm39) V420A probably benign Het
Snx14 T A 9: 88,297,746 (GRCm39) N174I probably damaging Het
Speer4e1 T C 5: 14,984,129 (GRCm39) N229S probably benign Het
Spopfm2 T C 3: 94,083,427 (GRCm39) D128G probably benign Het
Teddm3 A G 16: 20,971,685 (GRCm39) *295Q probably null Het
Tfap2c A G 2: 172,393,926 (GRCm39) D245G possibly damaging Het
Tfap2d A G 1: 19,178,508 (GRCm39) N191S probably benign Het
Tmt1b A T 10: 128,796,476 (GRCm39) M111K possibly damaging Het
Unc80 A G 1: 66,651,427 (GRCm39) R1591G possibly damaging Het
Vmn1r116 T C 7: 20,606,616 (GRCm39) W146R probably damaging Het
Vps13b C G 15: 35,925,535 (GRCm39) S3823R probably damaging Het
Wiz T A 17: 32,586,821 (GRCm39) D163V probably damaging Het
Xylt1 G C 7: 116,980,594 (GRCm39) A61P unknown Het
Zfp521 A C 18: 13,978,701 (GRCm39) F571V probably damaging Het
Zfp664 T A 5: 124,963,133 (GRCm39) C176S possibly damaging Het
Zfyve26 T C 12: 79,334,227 (GRCm39) N264D probably benign Het
Other mutations in Pip5k1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Pip5k1c APN 10 81,141,545 (GRCm39) missense probably benign 0.45
IGL02274:Pip5k1c APN 10 81,142,218 (GRCm39) missense probably damaging 1.00
IGL02500:Pip5k1c APN 10 81,153,155 (GRCm39) splice site probably null
IGL02565:Pip5k1c APN 10 81,153,155 (GRCm39) splice site probably null
IGL02577:Pip5k1c APN 10 81,153,155 (GRCm39) splice site probably null
IGL02579:Pip5k1c APN 10 81,153,155 (GRCm39) splice site probably null
IGL02581:Pip5k1c APN 10 81,153,155 (GRCm39) splice site probably null
IGL02604:Pip5k1c APN 10 81,153,155 (GRCm39) splice site probably null
IGL02610:Pip5k1c APN 10 81,153,155 (GRCm39) splice site probably null
IGL02613:Pip5k1c APN 10 81,153,155 (GRCm39) splice site probably null
IGL02616:Pip5k1c APN 10 81,153,155 (GRCm39) splice site probably null
IGL02617:Pip5k1c APN 10 81,153,155 (GRCm39) splice site probably null
IGL02639:Pip5k1c APN 10 81,153,155 (GRCm39) splice site probably null
IGL02641:Pip5k1c APN 10 81,153,155 (GRCm39) splice site probably null
IGL02642:Pip5k1c APN 10 81,153,155 (GRCm39) splice site probably null
IGL02724:Pip5k1c APN 10 81,149,296 (GRCm39) missense probably benign 0.01
IGL02751:Pip5k1c APN 10 81,153,155 (GRCm39) splice site probably null
PIT4366001:Pip5k1c UTSW 10 81,144,842 (GRCm39) missense probably damaging 0.98
R0257:Pip5k1c UTSW 10 81,150,930 (GRCm39) missense possibly damaging 0.86
R1643:Pip5k1c UTSW 10 81,150,828 (GRCm39) missense probably damaging 1.00
R1663:Pip5k1c UTSW 10 81,148,349 (GRCm39) missense probably damaging 1.00
R1872:Pip5k1c UTSW 10 81,142,153 (GRCm39) missense probably damaging 0.99
R2293:Pip5k1c UTSW 10 81,149,918 (GRCm39) missense possibly damaging 0.82
R2295:Pip5k1c UTSW 10 81,141,020 (GRCm39) missense probably benign 0.40
R2310:Pip5k1c UTSW 10 81,142,142 (GRCm39) missense probably damaging 0.96
R2406:Pip5k1c UTSW 10 81,144,858 (GRCm39) missense probably damaging 1.00
R4504:Pip5k1c UTSW 10 81,150,945 (GRCm39) missense probably damaging 0.98
R4772:Pip5k1c UTSW 10 81,151,774 (GRCm39) missense probably benign
R5022:Pip5k1c UTSW 10 81,146,723 (GRCm39) splice site probably null
R5023:Pip5k1c UTSW 10 81,146,723 (GRCm39) splice site probably null
R5033:Pip5k1c UTSW 10 81,141,084 (GRCm39) missense probably damaging 0.99
R5057:Pip5k1c UTSW 10 81,146,723 (GRCm39) splice site probably null
R5482:Pip5k1c UTSW 10 81,128,897 (GRCm39) missense probably damaging 0.98
R6305:Pip5k1c UTSW 10 81,151,768 (GRCm39) missense probably benign 0.02
R6511:Pip5k1c UTSW 10 81,146,651 (GRCm39) missense probably damaging 1.00
R6544:Pip5k1c UTSW 10 81,144,830 (GRCm39) missense probably damaging 1.00
R7512:Pip5k1c UTSW 10 81,150,953 (GRCm39) critical splice donor site probably null
R7581:Pip5k1c UTSW 10 81,144,794 (GRCm39) missense probably damaging 1.00
R8218:Pip5k1c UTSW 10 81,142,250 (GRCm39) missense probably damaging 1.00
R8927:Pip5k1c UTSW 10 81,128,906 (GRCm39) missense possibly damaging 0.95
R8928:Pip5k1c UTSW 10 81,128,906 (GRCm39) missense possibly damaging 0.95
R9048:Pip5k1c UTSW 10 81,152,710 (GRCm39) intron probably benign
R9049:Pip5k1c UTSW 10 81,152,710 (GRCm39) intron probably benign
R9100:Pip5k1c UTSW 10 81,145,056 (GRCm39) missense probably benign 0.01
R9443:Pip5k1c UTSW 10 81,153,184 (GRCm39) missense probably damaging 0.99
R9448:Pip5k1c UTSW 10 81,141,645 (GRCm39) missense probably damaging 1.00
R9466:Pip5k1c UTSW 10 81,152,710 (GRCm39) intron probably benign
R9775:Pip5k1c UTSW 10 81,147,853 (GRCm39) missense probably damaging 0.98
R9780:Pip5k1c UTSW 10 81,141,030 (GRCm39) missense probably benign 0.01
Z1177:Pip5k1c UTSW 10 81,150,866 (GRCm39) missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- GCCCACCAGGTTACTCTTAC -3'
(R):5'- AGTGGGAGTCTTGAACACTGG -3'

Sequencing Primer
(F):5'- GGCCATGCCCACCTACTC -3'
(R):5'- TCACTGAGACAGGGGCTGTG -3'
Posted On 2021-03-08