Incidental Mutation 'R8686:Pip5k1c'
ID 662055
Institutional Source Beutler Lab
Gene Symbol Pip5k1c
Ensembl Gene ENSMUSG00000034902
Gene Name phosphatidylinositol-4-phosphate 5-kinase, type 1 gamma
Synonyms PIP5KIgamma
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8686 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 81292963-81319973 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 81311993 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Asparagine at position 411 (H411N)
Ref Sequence ENSEMBL: ENSMUSP00000038225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045469] [ENSMUST00000105327] [ENSMUST00000160291] [ENSMUST00000161719] [ENSMUST00000161854] [ENSMUST00000161869] [ENSMUST00000163075]
AlphaFold O70161
Predicted Effect probably damaging
Transcript: ENSMUST00000045469
AA Change: H411N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038225
Gene: ENSMUSG00000034902
AA Change: H411N

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 69 78 N/A INTRINSIC
PIPKc 103 444 2.72e-164 SMART
low complexity region 518 534 N/A INTRINSIC
low complexity region 575 591 N/A INTRINSIC
low complexity region 601 628 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105327
AA Change: H411N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000100964
Gene: ENSMUSG00000034902
AA Change: H411N

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 69 78 N/A INTRINSIC
PIPKc 103 444 2.72e-164 SMART
low complexity region 518 534 N/A INTRINSIC
low complexity region 575 591 N/A INTRINSIC
low complexity region 601 628 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160291
SMART Domains Protein: ENSMUSP00000125645
Gene: ENSMUSG00000034902

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161586
SMART Domains Protein: ENSMUSP00000124612
Gene: ENSMUSG00000034902

DomainStartEndE-ValueType
low complexity region 28 44 N/A INTRINSIC
low complexity region 54 81 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000161719
AA Change: H101N

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125461
Gene: ENSMUSG00000034902
AA Change: H101N

DomainStartEndE-ValueType
Pfam:PIP5K 1 133 1.4e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161854
SMART Domains Protein: ENSMUSP00000124004
Gene: ENSMUSG00000034902

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161869
SMART Domains Protein: ENSMUSP00000124235
Gene: ENSMUSG00000034902

DomainStartEndE-ValueType
low complexity region 7 36 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163075
AA Change: H411N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124155
Gene: ENSMUSG00000034902
AA Change: H411N

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 69 78 N/A INTRINSIC
PIPKc 103 444 2.72e-164 SMART
low complexity region 518 534 N/A INTRINSIC
low complexity region 575 591 N/A INTRINSIC
low complexity region 601 628 N/A INTRINSIC
Meta Mutation Damage Score 0.5076 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a type I phosphatidylinositol 4-phosphate 5-kinase. The encoded protein catalyzes phosphorylation of phosphatidylinositol 4-phosphate, producing phosphatidylinositol 4,5-bisphosphate. This enzyme is found at synapses and has been found to play roles in endocytosis and cell migration. Mutations at this locus have been associated with lethal congenital contractural syndrome. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Sep 2010]
PHENOTYPE: Mutations in this locus cause variable phenotypes. One allele shows embryonic lethality, abnormal cardiovascular and neuronal development and impaired integrity of the megakaryocyte membrane cytoskeleton. Another allele exhibits neonatal lethality, synaptic transmission and plasticity defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik C T 9: 103,259,428 A525T probably benign Het
Adam25 A G 8: 40,755,484 T596A probably benign Het
Adamts6 A G 13: 104,313,699 I303V probably damaging Het
Alpl A T 4: 137,743,801 H341Q probably damaging Het
Cachd1 G A 4: 100,988,128 R939H probably damaging Het
Ccdc114 A G 7: 45,947,692 T456A probably benign Het
Cd22 G A 7: 30,870,069 R541C probably benign Het
Cenpf A T 1: 189,659,604 M660K probably benign Het
Cmya5 A T 13: 93,095,380 S1067T possibly damaging Het
Col5a2 C T 1: 45,421,987 G250D probably damaging Het
Cylc2 C T 4: 51,229,651 T331M unknown Het
Dgka A G 10: 128,733,093 M201T probably benign Het
Dnajc13 T C 9: 104,170,805 I1804V probably benign Het
Dym T A 18: 75,286,683 Y642N probably damaging Het
Efr3b A T 12: 4,000,886 D26E probably damaging Het
Emilin1 A T 5: 30,917,696 K427M possibly damaging Het
Fam187b T C 7: 30,977,234 L56S probably benign Het
Fbxo18 C T 2: 11,755,658 V694I probably benign Het
Fgd2 C T 17: 29,379,023 T644I probably benign Het
G6pc T G 11: 101,374,707 probably null Het
Gli2 A G 1: 118,836,687 S1245P probably benign Het
Gm10696 T C 3: 94,176,120 D128G probably benign Het
Gpr137b T C 13: 13,359,406 Y355C Het
Ighv1-84 T C 12: 115,980,904 D50G probably benign Het
Impdh1 C A 6: 29,216,215 probably benign Het
Irf4 A T 13: 30,761,450 D393V possibly damaging Het
Kalrn A G 16: 34,360,935 L111P probably damaging Het
Lrch3 T C 16: 32,981,853 V58A possibly damaging Het
Lrif1 C T 3: 106,732,781 T394I probably damaging Het
Map4k1 A G 7: 28,994,073 T434A probably benign Het
Mcur1 G A 13: 43,541,717 T327M probably damaging Het
Mettl7b A T 10: 128,960,607 M111K possibly damaging Het
Myo9b G T 8: 71,334,322 S716I probably benign Het
Nol10 T A 12: 17,369,771 probably benign Het
Nos3 A G 5: 24,368,843 T202A possibly damaging Het
Olfr128 T C 17: 37,924,277 V237A probably benign Het
Olfr710 A C 7: 106,944,698 M101R probably benign Het
Parp12 A T 6: 39,117,922 S80T probably benign Het
Pde1a C T 2: 79,927,742 V50I probably benign Het
Pfkl A T 10: 77,997,522 probably null Het
Phkg1 A T 5: 129,866,215 Y207N probably damaging Het
Pik3r4 A G 9: 105,658,529 T640A possibly damaging Het
Pla2g4e A G 2: 120,244,691 S73P probably damaging Het
Polr2b T C 5: 77,335,663 V662A probably damaging Het
Prss43 C T 9: 110,829,426 R265C possibly damaging Het
Rap1b A T 10: 117,822,841 V29D probably damaging Het
Rraga A G 4: 86,576,811 E298G probably damaging Het
Rrp8 A T 7: 105,733,574 I418N probably damaging Het
Siglecf T C 7: 43,355,606 V420A probably benign Het
Snx14 T A 9: 88,415,693 N174I probably damaging Het
Speer4e T C 5: 14,934,115 N229S probably benign Het
Teddm3 A G 16: 21,152,935 *295Q probably null Het
Tfap2c A G 2: 172,552,006 D245G possibly damaging Het
Tfap2d A G 1: 19,108,284 N191S probably benign Het
Unc80 A G 1: 66,612,268 R1591G possibly damaging Het
Vmn1r116 T C 7: 20,872,691 W146R probably damaging Het
Vps13b C G 15: 35,925,389 S3823R probably damaging Het
Wiz T A 17: 32,367,847 D163V probably damaging Het
Xylt1 G C 7: 117,381,359 A61P unknown Het
Zfp521 A C 18: 13,845,644 F571V probably damaging Het
Zfp664 T A 5: 124,886,069 C176S possibly damaging Het
Zfyve26 T C 12: 79,287,453 N264D probably benign Het
Other mutations in Pip5k1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Pip5k1c APN 10 81305711 missense probably benign 0.45
IGL02274:Pip5k1c APN 10 81306384 missense probably damaging 1.00
IGL02500:Pip5k1c APN 10 81317321 splice site probably null
IGL02565:Pip5k1c APN 10 81317321 splice site probably null
IGL02577:Pip5k1c APN 10 81317321 splice site probably null
IGL02579:Pip5k1c APN 10 81317321 splice site probably null
IGL02581:Pip5k1c APN 10 81317321 splice site probably null
IGL02604:Pip5k1c APN 10 81317321 splice site probably null
IGL02610:Pip5k1c APN 10 81317321 splice site probably null
IGL02613:Pip5k1c APN 10 81317321 splice site probably null
IGL02616:Pip5k1c APN 10 81317321 splice site probably null
IGL02617:Pip5k1c APN 10 81317321 splice site probably null
IGL02639:Pip5k1c APN 10 81317321 splice site probably null
IGL02641:Pip5k1c APN 10 81317321 splice site probably null
IGL02642:Pip5k1c APN 10 81317321 splice site probably null
IGL02724:Pip5k1c APN 10 81313462 missense probably benign 0.01
IGL02751:Pip5k1c APN 10 81317321 splice site probably null
PIT4366001:Pip5k1c UTSW 10 81309008 missense probably damaging 0.98
R0257:Pip5k1c UTSW 10 81315096 missense possibly damaging 0.86
R1643:Pip5k1c UTSW 10 81314994 missense probably damaging 1.00
R1663:Pip5k1c UTSW 10 81312515 missense probably damaging 1.00
R1872:Pip5k1c UTSW 10 81306319 missense probably damaging 0.99
R2293:Pip5k1c UTSW 10 81314084 missense possibly damaging 0.82
R2295:Pip5k1c UTSW 10 81305186 missense probably benign 0.40
R2310:Pip5k1c UTSW 10 81306308 missense probably damaging 0.96
R2406:Pip5k1c UTSW 10 81309024 missense probably damaging 1.00
R4504:Pip5k1c UTSW 10 81315111 missense probably damaging 0.98
R4772:Pip5k1c UTSW 10 81315940 missense probably benign
R5022:Pip5k1c UTSW 10 81310889 splice site probably null
R5023:Pip5k1c UTSW 10 81310889 splice site probably null
R5033:Pip5k1c UTSW 10 81305250 missense probably damaging 0.99
R5057:Pip5k1c UTSW 10 81310889 splice site probably null
R5482:Pip5k1c UTSW 10 81293063 missense probably damaging 0.98
R6305:Pip5k1c UTSW 10 81315934 missense probably benign 0.02
R6511:Pip5k1c UTSW 10 81310817 missense probably damaging 1.00
R6544:Pip5k1c UTSW 10 81308996 missense probably damaging 1.00
R7512:Pip5k1c UTSW 10 81315119 critical splice donor site probably null
R7581:Pip5k1c UTSW 10 81308960 missense probably damaging 1.00
R8218:Pip5k1c UTSW 10 81306416 missense probably damaging 1.00
R8927:Pip5k1c UTSW 10 81293072 missense possibly damaging 0.95
R8928:Pip5k1c UTSW 10 81293072 missense possibly damaging 0.95
R9048:Pip5k1c UTSW 10 81316876 intron probably benign
R9049:Pip5k1c UTSW 10 81316876 intron probably benign
R9100:Pip5k1c UTSW 10 81309222 missense probably benign 0.01
R9443:Pip5k1c UTSW 10 81317350 missense probably damaging 0.99
R9448:Pip5k1c UTSW 10 81305811 missense probably damaging 1.00
R9466:Pip5k1c UTSW 10 81316876 intron probably benign
Z1177:Pip5k1c UTSW 10 81315032 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- GCCCACCAGGTTACTCTTAC -3'
(R):5'- AGTGGGAGTCTTGAACACTGG -3'

Sequencing Primer
(F):5'- GGCCATGCCCACCTACTC -3'
(R):5'- TCACTGAGACAGGGGCTGTG -3'
Posted On 2021-03-08