Incidental Mutation 'R8686:Rap1b'
ID 662056
Institutional Source Beutler Lab
Gene Symbol Rap1b
Ensembl Gene ENSMUSG00000052681
Gene Name RAS related protein 1b
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.685) question?
Stock # R8686 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 117813871-117846035 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 117822841 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 29 (V29D)
Ref Sequence ENSEMBL: ENSMUSP00000066238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064667] [ENSMUST00000220214]
AlphaFold Q99JI6
Predicted Effect probably damaging
Transcript: ENSMUST00000064667
AA Change: V29D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000066238
Gene: ENSMUSG00000052681
AA Change: V29D

DomainStartEndE-ValueType
RAS 1 168 2.4e-122 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220214
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RAS-like small GTP-binding protein superfamily. Members of this family regulate multiple cellular processes including cell adhesion and growth and differentiation. This protein localizes to cellular membranes and has been shown to regulate integrin-mediated cell signaling. This protein also plays a role in regulating outside-in signaling in platelets. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 3, 5, 6 and 9. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display partial embryonic and perinatal lethality, abdominal, cranial, and hepatic bleeding in mice that die in utero, reduced platelet aggregation, and decreased thrombus formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik C T 9: 103,259,428 A525T probably benign Het
Adam25 A G 8: 40,755,484 T596A probably benign Het
Adamts6 A G 13: 104,313,699 I303V probably damaging Het
Alpl A T 4: 137,743,801 H341Q probably damaging Het
Cachd1 G A 4: 100,988,128 R939H probably damaging Het
Ccdc114 A G 7: 45,947,692 T456A probably benign Het
Cd22 G A 7: 30,870,069 R541C probably benign Het
Cenpf A T 1: 189,659,604 M660K probably benign Het
Cmya5 A T 13: 93,095,380 S1067T possibly damaging Het
Col5a2 C T 1: 45,421,987 G250D probably damaging Het
Cylc2 C T 4: 51,229,651 T331M unknown Het
Dgka A G 10: 128,733,093 M201T probably benign Het
Dnajc13 T C 9: 104,170,805 I1804V probably benign Het
Dym T A 18: 75,286,683 Y642N probably damaging Het
Efr3b A T 12: 4,000,886 D26E probably damaging Het
Emilin1 A T 5: 30,917,696 K427M possibly damaging Het
Fam187b T C 7: 30,977,234 L56S probably benign Het
Fbxo18 C T 2: 11,755,658 V694I probably benign Het
Fgd2 C T 17: 29,379,023 T644I probably benign Het
G6pc T G 11: 101,374,707 probably null Het
Gli2 A G 1: 118,836,687 S1245P probably benign Het
Gm10696 T C 3: 94,176,120 D128G probably benign Het
Gpr137b T C 13: 13,359,406 Y355C Het
Ighv1-84 T C 12: 115,980,904 D50G probably benign Het
Impdh1 C A 6: 29,216,215 probably benign Het
Irf4 A T 13: 30,761,450 D393V possibly damaging Het
Kalrn A G 16: 34,360,935 L111P probably damaging Het
Lrch3 T C 16: 32,981,853 V58A possibly damaging Het
Lrif1 C T 3: 106,732,781 T394I probably damaging Het
Map4k1 A G 7: 28,994,073 T434A probably benign Het
Mcur1 G A 13: 43,541,717 T327M probably damaging Het
Mettl7b A T 10: 128,960,607 M111K possibly damaging Het
Myo9b G T 8: 71,334,322 S716I probably benign Het
Nol10 T A 12: 17,369,771 probably benign Het
Nos3 A G 5: 24,368,843 T202A possibly damaging Het
Olfr128 T C 17: 37,924,277 V237A probably benign Het
Olfr710 A C 7: 106,944,698 M101R probably benign Het
Parp12 A T 6: 39,117,922 S80T probably benign Het
Pde1a C T 2: 79,927,742 V50I probably benign Het
Pfkl A T 10: 77,997,522 probably null Het
Phkg1 A T 5: 129,866,215 Y207N probably damaging Het
Pik3r4 A G 9: 105,658,529 T640A possibly damaging Het
Pip5k1c C A 10: 81,311,993 H411N probably damaging Het
Pla2g4e A G 2: 120,244,691 S73P probably damaging Het
Polr2b T C 5: 77,335,663 V662A probably damaging Het
Prss43 C T 9: 110,829,426 R265C possibly damaging Het
Rraga A G 4: 86,576,811 E298G probably damaging Het
Rrp8 A T 7: 105,733,574 I418N probably damaging Het
Siglecf T C 7: 43,355,606 V420A probably benign Het
Snx14 T A 9: 88,415,693 N174I probably damaging Het
Speer4e T C 5: 14,934,115 N229S probably benign Het
Teddm3 A G 16: 21,152,935 *295Q probably null Het
Tfap2c A G 2: 172,552,006 D245G possibly damaging Het
Tfap2d A G 1: 19,108,284 N191S probably benign Het
Unc80 A G 1: 66,612,268 R1591G possibly damaging Het
Vmn1r116 T C 7: 20,872,691 W146R probably damaging Het
Vps13b C G 15: 35,925,389 S3823R probably damaging Het
Wiz T A 17: 32,367,847 D163V probably damaging Het
Xylt1 G C 7: 117,381,359 A61P unknown Het
Zfp521 A C 18: 13,845,644 F571V probably damaging Het
Zfp664 T A 5: 124,886,069 C176S possibly damaging Het
Zfyve26 T C 12: 79,287,453 N264D probably benign Het
Other mutations in Rap1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01932:Rap1b APN 10 117822860 missense probably damaging 1.00
IGL02539:Rap1b APN 10 117822804 missense possibly damaging 0.82
IGL03286:Rap1b APN 10 117818575 nonsense probably null
R0591:Rap1b UTSW 10 117818617 unclassified probably benign
R1939:Rap1b UTSW 10 117818586 missense probably damaging 1.00
R2509:Rap1b UTSW 10 117818539 missense probably damaging 0.98
R2902:Rap1b UTSW 10 117824602 missense probably damaging 1.00
R4825:Rap1b UTSW 10 117818582 missense probably benign 0.04
R5131:Rap1b UTSW 10 117824611 missense probably damaging 0.96
R6084:Rap1b UTSW 10 117824611 missense probably damaging 0.96
R6186:Rap1b UTSW 10 117820552 missense probably damaging 1.00
R6737:Rap1b UTSW 10 117822808 missense probably damaging 0.97
R7026:Rap1b UTSW 10 117818479 missense probably benign 0.01
R7530:Rap1b UTSW 10 117817452 nonsense probably null
R8069:Rap1b UTSW 10 117821609 missense probably damaging 1.00
R9163:Rap1b UTSW 10 117818486 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- AGATAGCACGTGAACACTCC -3'
(R):5'- TGAGTCACTGTTGTACTCACTG -3'

Sequencing Primer
(F):5'- GATAGCACGTGAACACTCCACTAAC -3'
(R):5'- ATATGATCAGTGCACACGTGGTC -3'
Posted On 2021-03-08