Incidental Mutation 'R8686:Dgka'
ID 662057
Institutional Source Beutler Lab
Gene Symbol Dgka
Ensembl Gene ENSMUSG00000025357
Gene Name diacylglycerol kinase, alpha
Synonyms Dagk1
MMRRC Submission 068541-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.366) question?
Stock # R8686 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 128556003-128580724 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 128568962 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 201 (M201T)
Ref Sequence ENSEMBL: ENSMUSP00000026414 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026414] [ENSMUST00000219834]
AlphaFold O88673
Predicted Effect probably benign
Transcript: ENSMUST00000026414
AA Change: M201T

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000026414
Gene: ENSMUSG00000025357
AA Change: M201T

DomainStartEndE-ValueType
Pfam:DAG_kinase_N 4 93 6.9e-31 PFAM
EFh 115 143 3.82e0 SMART
EFh 160 188 1.29e-4 SMART
C1 207 254 2.29e-10 SMART
C1 269 320 6.91e-5 SMART
DAGKc 372 495 3.11e-62 SMART
DAGKa 515 696 4.1e-103 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000219834
AA Change: M201T

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the eukaryotic diacylglycerol kinase family. It acts as a modulator that competes with protein kinase C for the second messenger diacylglycerol in intracellular signaling pathways. It also plays an important role in the resynthesis of phosphatidylinositols and phosphorylating diacylglycerol to phosphatidic acid. Alternative splicing occurs at this locus and four transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in impaired induction of T cell anergy. T cells stimulated in anergy producing conditions show increased proliferation and interleukin 2 production. Mice homozygous for a transgenic gene disruption exhibit male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 A G 8: 41,208,521 (GRCm39) T596A probably benign Het
Adamts6 A G 13: 104,450,207 (GRCm39) I303V probably damaging Het
Alpl A T 4: 137,471,112 (GRCm39) H341Q probably damaging Het
Cachd1 G A 4: 100,845,325 (GRCm39) R939H probably damaging Het
Cd22 G A 7: 30,569,494 (GRCm39) R541C probably benign Het
Cenpf A T 1: 189,391,801 (GRCm39) M660K probably benign Het
Cmya5 A T 13: 93,231,888 (GRCm39) S1067T possibly damaging Het
Col5a2 C T 1: 45,461,147 (GRCm39) G250D probably damaging Het
Cylc2 C T 4: 51,229,651 (GRCm39) T331M unknown Het
Dnajc13 T C 9: 104,048,004 (GRCm39) I1804V probably benign Het
Dym T A 18: 75,419,754 (GRCm39) Y642N probably damaging Het
Efr3b A T 12: 4,050,886 (GRCm39) D26E probably damaging Het
Emilin1 A T 5: 31,075,040 (GRCm39) K427M possibly damaging Het
Fam187b T C 7: 30,676,659 (GRCm39) L56S probably benign Het
Fbh1 C T 2: 11,760,469 (GRCm39) V694I probably benign Het
Fgd2 C T 17: 29,597,997 (GRCm39) T644I probably benign Het
G6pc1 T G 11: 101,265,533 (GRCm39) probably null Het
Gli2 A G 1: 118,764,417 (GRCm39) S1245P probably benign Het
Gpr137b T C 13: 13,533,991 (GRCm39) Y355C Het
Ighv1-84 T C 12: 115,944,524 (GRCm39) D50G probably benign Het
Impdh1 C A 6: 29,216,214 (GRCm39) probably benign Het
Inhca C T 9: 103,136,627 (GRCm39) A525T probably benign Het
Irf4 A T 13: 30,945,433 (GRCm39) D393V possibly damaging Het
Kalrn A G 16: 34,181,305 (GRCm39) L111P probably damaging Het
Lrch3 T C 16: 32,802,223 (GRCm39) V58A possibly damaging Het
Lrif1 C T 3: 106,640,097 (GRCm39) T394I probably damaging Het
Map4k1 A G 7: 28,693,498 (GRCm39) T434A probably benign Het
Mcur1 G A 13: 43,695,193 (GRCm39) T327M probably damaging Het
Myo9b G T 8: 71,786,966 (GRCm39) S716I probably benign Het
Nol10 T A 12: 17,419,772 (GRCm39) probably benign Het
Nos3 A G 5: 24,573,841 (GRCm39) T202A possibly damaging Het
Odad1 A G 7: 45,597,116 (GRCm39) T456A probably benign Het
Or14j7 T C 17: 38,235,168 (GRCm39) V237A probably benign Het
Or2d4 A C 7: 106,543,905 (GRCm39) M101R probably benign Het
Parp12 A T 6: 39,094,856 (GRCm39) S80T probably benign Het
Pde1a C T 2: 79,758,086 (GRCm39) V50I probably benign Het
Pfkl A T 10: 77,833,356 (GRCm39) probably null Het
Phkg1 A T 5: 129,895,056 (GRCm39) Y207N probably damaging Het
Pik3r4 A G 9: 105,535,728 (GRCm39) T640A possibly damaging Het
Pip5k1c C A 10: 81,147,827 (GRCm39) H411N probably damaging Het
Pla2g4e A G 2: 120,075,172 (GRCm39) S73P probably damaging Het
Polr2b T C 5: 77,483,510 (GRCm39) V662A probably damaging Het
Prss43 C T 9: 110,658,494 (GRCm39) R265C possibly damaging Het
Rap1b A T 10: 117,658,746 (GRCm39) V29D probably damaging Het
Rraga A G 4: 86,495,048 (GRCm39) E298G probably damaging Het
Rrp8 A T 7: 105,382,781 (GRCm39) I418N probably damaging Het
Siglecf T C 7: 43,005,030 (GRCm39) V420A probably benign Het
Snx14 T A 9: 88,297,746 (GRCm39) N174I probably damaging Het
Speer4e1 T C 5: 14,984,129 (GRCm39) N229S probably benign Het
Spopfm2 T C 3: 94,083,427 (GRCm39) D128G probably benign Het
Teddm3 A G 16: 20,971,685 (GRCm39) *295Q probably null Het
Tfap2c A G 2: 172,393,926 (GRCm39) D245G possibly damaging Het
Tfap2d A G 1: 19,178,508 (GRCm39) N191S probably benign Het
Tmt1b A T 10: 128,796,476 (GRCm39) M111K possibly damaging Het
Unc80 A G 1: 66,651,427 (GRCm39) R1591G possibly damaging Het
Vmn1r116 T C 7: 20,606,616 (GRCm39) W146R probably damaging Het
Vps13b C G 15: 35,925,535 (GRCm39) S3823R probably damaging Het
Wiz T A 17: 32,586,821 (GRCm39) D163V probably damaging Het
Xylt1 G C 7: 116,980,594 (GRCm39) A61P unknown Het
Zfp521 A C 18: 13,978,701 (GRCm39) F571V probably damaging Het
Zfp664 T A 5: 124,963,133 (GRCm39) C176S possibly damaging Het
Zfyve26 T C 12: 79,334,227 (GRCm39) N264D probably benign Het
Other mutations in Dgka
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Dgka APN 10 128,568,955 (GRCm39) missense probably damaging 1.00
IGL02479:Dgka APN 10 128,566,115 (GRCm39) missense probably benign 0.01
IGL02727:Dgka APN 10 128,558,317 (GRCm39) splice site probably benign
IGL02817:Dgka APN 10 128,566,097 (GRCm39) missense probably benign
IGL02882:Dgka APN 10 128,569,253 (GRCm39) missense possibly damaging 0.77
IGL03239:Dgka APN 10 128,557,254 (GRCm39) splice site probably benign
Caps UTSW 10 128,566,071 (GRCm39) nonsense probably null
Greenie UTSW 10 128,568,962 (GRCm39) missense probably benign 0.03
Hangup UTSW 10 128,556,356 (GRCm39) missense probably damaging 1.00
Stickem UTSW 10 128,559,548 (GRCm39) missense probably damaging 1.00
R0321:Dgka UTSW 10 128,556,952 (GRCm39) splice site probably benign
R0374:Dgka UTSW 10 128,556,952 (GRCm39) splice site probably benign
R0482:Dgka UTSW 10 128,569,990 (GRCm39) nonsense probably null
R0494:Dgka UTSW 10 128,556,952 (GRCm39) splice site probably benign
R0573:Dgka UTSW 10 128,572,876 (GRCm39) critical splice donor site probably null
R0594:Dgka UTSW 10 128,568,979 (GRCm39) splice site probably benign
R0607:Dgka UTSW 10 128,556,338 (GRCm39) splice site probably null
R0618:Dgka UTSW 10 128,556,952 (GRCm39) splice site probably benign
R0691:Dgka UTSW 10 128,559,129 (GRCm39) splice site probably benign
R1378:Dgka UTSW 10 128,571,696 (GRCm39) splice site probably null
R1424:Dgka UTSW 10 128,569,202 (GRCm39) missense possibly damaging 0.57
R1955:Dgka UTSW 10 128,566,058 (GRCm39) critical splice donor site probably null
R1972:Dgka UTSW 10 128,556,335 (GRCm39) missense probably damaging 0.99
R1998:Dgka UTSW 10 128,565,808 (GRCm39) missense probably benign 0.00
R2046:Dgka UTSW 10 128,559,404 (GRCm39) missense probably damaging 1.00
R4206:Dgka UTSW 10 128,557,064 (GRCm39) missense probably damaging 1.00
R4418:Dgka UTSW 10 128,563,963 (GRCm39) missense probably damaging 1.00
R4752:Dgka UTSW 10 128,572,528 (GRCm39) missense probably benign 0.03
R5092:Dgka UTSW 10 128,571,702 (GRCm39) missense probably damaging 0.99
R5479:Dgka UTSW 10 128,565,541 (GRCm39) critical splice acceptor site probably null
R6009:Dgka UTSW 10 128,559,548 (GRCm39) missense probably damaging 1.00
R6273:Dgka UTSW 10 128,559,515 (GRCm39) missense probably benign 0.03
R6852:Dgka UTSW 10 128,558,408 (GRCm39) missense probably damaging 1.00
R6947:Dgka UTSW 10 128,568,884 (GRCm39) missense probably damaging 1.00
R6973:Dgka UTSW 10 128,565,463 (GRCm39) splice site probably null
R7024:Dgka UTSW 10 128,556,356 (GRCm39) missense probably damaging 1.00
R7076:Dgka UTSW 10 128,569,452 (GRCm39) missense probably damaging 0.99
R7290:Dgka UTSW 10 128,569,468 (GRCm39) missense probably damaging 0.99
R7397:Dgka UTSW 10 128,556,594 (GRCm39) missense possibly damaging 0.95
R7823:Dgka UTSW 10 128,572,135 (GRCm39) missense probably benign 0.00
R7856:Dgka UTSW 10 128,572,533 (GRCm39) missense probably benign
R8118:Dgka UTSW 10 128,558,318 (GRCm39) splice site probably null
R8360:Dgka UTSW 10 128,563,997 (GRCm39) missense probably damaging 0.99
R8374:Dgka UTSW 10 128,557,112 (GRCm39) missense probably benign 0.01
R8547:Dgka UTSW 10 128,556,881 (GRCm39) missense probably damaging 1.00
R9013:Dgka UTSW 10 128,566,071 (GRCm39) nonsense probably null
R9307:Dgka UTSW 10 128,567,046 (GRCm39) missense probably damaging 1.00
R9336:Dgka UTSW 10 128,566,935 (GRCm39) critical splice donor site probably null
R9423:Dgka UTSW 10 128,557,055 (GRCm39) missense probably damaging 0.96
X0020:Dgka UTSW 10 128,557,186 (GRCm39) missense probably damaging 1.00
Z1177:Dgka UTSW 10 128,556,337 (GRCm39) missense probably benign 0.00
Z1177:Dgka UTSW 10 128,567,034 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- ATAGGCTTGGGCTTTAGCAC -3'
(R):5'- CAGTGGCTCTGTGTCTCTAGAC -3'

Sequencing Primer
(F):5'- TTGCTTCCCCAGGATCATAGAGAG -3'
(R):5'- TCTCTAGACGAGTGGGTCC -3'
Posted On 2021-03-08