Incidental Mutation 'R8686:Efr3b'
ID 662060
Institutional Source Beutler Lab
Gene Symbol Efr3b
Ensembl Gene ENSMUSG00000020658
Gene Name EFR3 homolog B
Synonyms C030014M07Rik
MMRRC Submission 068541-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8686 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 4012554-4088915 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 4050886 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 26 (D26E)
Ref Sequence ENSEMBL: ENSMUSP00000106809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111178]
AlphaFold Q6ZQ18
Predicted Effect probably damaging
Transcript: ENSMUST00000111178
AA Change: D26E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106809
Gene: ENSMUSG00000020658
AA Change: D26E

DomainStartEndE-ValueType
SCOP:d1qbkb_ 55 306 1e-3 SMART
low complexity region 591 602 N/A INTRINSIC
low complexity region 736 749 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 A G 8: 41,208,521 (GRCm39) T596A probably benign Het
Adamts6 A G 13: 104,450,207 (GRCm39) I303V probably damaging Het
Alpl A T 4: 137,471,112 (GRCm39) H341Q probably damaging Het
Cachd1 G A 4: 100,845,325 (GRCm39) R939H probably damaging Het
Cd22 G A 7: 30,569,494 (GRCm39) R541C probably benign Het
Cenpf A T 1: 189,391,801 (GRCm39) M660K probably benign Het
Cmya5 A T 13: 93,231,888 (GRCm39) S1067T possibly damaging Het
Col5a2 C T 1: 45,461,147 (GRCm39) G250D probably damaging Het
Cylc2 C T 4: 51,229,651 (GRCm39) T331M unknown Het
Dgka A G 10: 128,568,962 (GRCm39) M201T probably benign Het
Dnajc13 T C 9: 104,048,004 (GRCm39) I1804V probably benign Het
Dym T A 18: 75,419,754 (GRCm39) Y642N probably damaging Het
Emilin1 A T 5: 31,075,040 (GRCm39) K427M possibly damaging Het
Fam187b T C 7: 30,676,659 (GRCm39) L56S probably benign Het
Fbh1 C T 2: 11,760,469 (GRCm39) V694I probably benign Het
Fgd2 C T 17: 29,597,997 (GRCm39) T644I probably benign Het
G6pc1 T G 11: 101,265,533 (GRCm39) probably null Het
Gli2 A G 1: 118,764,417 (GRCm39) S1245P probably benign Het
Gpr137b T C 13: 13,533,991 (GRCm39) Y355C Het
Ighv1-84 T C 12: 115,944,524 (GRCm39) D50G probably benign Het
Impdh1 C A 6: 29,216,214 (GRCm39) probably benign Het
Inhca C T 9: 103,136,627 (GRCm39) A525T probably benign Het
Irf4 A T 13: 30,945,433 (GRCm39) D393V possibly damaging Het
Kalrn A G 16: 34,181,305 (GRCm39) L111P probably damaging Het
Lrch3 T C 16: 32,802,223 (GRCm39) V58A possibly damaging Het
Lrif1 C T 3: 106,640,097 (GRCm39) T394I probably damaging Het
Map4k1 A G 7: 28,693,498 (GRCm39) T434A probably benign Het
Mcur1 G A 13: 43,695,193 (GRCm39) T327M probably damaging Het
Myo9b G T 8: 71,786,966 (GRCm39) S716I probably benign Het
Nol10 T A 12: 17,419,772 (GRCm39) probably benign Het
Nos3 A G 5: 24,573,841 (GRCm39) T202A possibly damaging Het
Odad1 A G 7: 45,597,116 (GRCm39) T456A probably benign Het
Or14j7 T C 17: 38,235,168 (GRCm39) V237A probably benign Het
Or2d4 A C 7: 106,543,905 (GRCm39) M101R probably benign Het
Parp12 A T 6: 39,094,856 (GRCm39) S80T probably benign Het
Pde1a C T 2: 79,758,086 (GRCm39) V50I probably benign Het
Pfkl A T 10: 77,833,356 (GRCm39) probably null Het
Phkg1 A T 5: 129,895,056 (GRCm39) Y207N probably damaging Het
Pik3r4 A G 9: 105,535,728 (GRCm39) T640A possibly damaging Het
Pip5k1c C A 10: 81,147,827 (GRCm39) H411N probably damaging Het
Pla2g4e A G 2: 120,075,172 (GRCm39) S73P probably damaging Het
Polr2b T C 5: 77,483,510 (GRCm39) V662A probably damaging Het
Prss43 C T 9: 110,658,494 (GRCm39) R265C possibly damaging Het
Rap1b A T 10: 117,658,746 (GRCm39) V29D probably damaging Het
Rraga A G 4: 86,495,048 (GRCm39) E298G probably damaging Het
Rrp8 A T 7: 105,382,781 (GRCm39) I418N probably damaging Het
Siglecf T C 7: 43,005,030 (GRCm39) V420A probably benign Het
Snx14 T A 9: 88,297,746 (GRCm39) N174I probably damaging Het
Speer4e1 T C 5: 14,984,129 (GRCm39) N229S probably benign Het
Spopfm2 T C 3: 94,083,427 (GRCm39) D128G probably benign Het
Teddm3 A G 16: 20,971,685 (GRCm39) *295Q probably null Het
Tfap2c A G 2: 172,393,926 (GRCm39) D245G possibly damaging Het
Tfap2d A G 1: 19,178,508 (GRCm39) N191S probably benign Het
Tmt1b A T 10: 128,796,476 (GRCm39) M111K possibly damaging Het
Unc80 A G 1: 66,651,427 (GRCm39) R1591G possibly damaging Het
Vmn1r116 T C 7: 20,606,616 (GRCm39) W146R probably damaging Het
Vps13b C G 15: 35,925,535 (GRCm39) S3823R probably damaging Het
Wiz T A 17: 32,586,821 (GRCm39) D163V probably damaging Het
Xylt1 G C 7: 116,980,594 (GRCm39) A61P unknown Het
Zfp521 A C 18: 13,978,701 (GRCm39) F571V probably damaging Het
Zfp664 T A 5: 124,963,133 (GRCm39) C176S possibly damaging Het
Zfyve26 T C 12: 79,334,227 (GRCm39) N264D probably benign Het
Other mutations in Efr3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Efr3b APN 12 4,025,411 (GRCm39) nonsense probably null
IGL01288:Efr3b APN 12 4,032,865 (GRCm39) missense probably damaging 1.00
IGL01467:Efr3b APN 12 4,019,597 (GRCm39) missense probably damaging 0.98
IGL01964:Efr3b APN 12 4,032,928 (GRCm39) missense probably damaging 1.00
IGL02253:Efr3b APN 12 4,033,391 (GRCm39) missense probably benign 0.40
IGL02329:Efr3b APN 12 4,042,923 (GRCm39) splice site probably null
IGL02365:Efr3b APN 12 4,033,391 (GRCm39) missense probably benign 0.40
IGL02373:Efr3b APN 12 4,033,391 (GRCm39) missense probably benign 0.40
IGL02390:Efr3b APN 12 4,033,391 (GRCm39) missense probably benign 0.40
IGL02392:Efr3b APN 12 4,033,391 (GRCm39) missense probably benign 0.40
IGL02494:Efr3b APN 12 4,033,391 (GRCm39) missense probably benign 0.40
IGL02496:Efr3b APN 12 4,033,391 (GRCm39) missense probably benign 0.40
IGL02501:Efr3b APN 12 4,033,391 (GRCm39) missense probably benign 0.40
IGL02529:Efr3b APN 12 4,033,391 (GRCm39) missense probably benign 0.40
IGL02530:Efr3b APN 12 4,033,391 (GRCm39) missense probably benign 0.40
IGL02532:Efr3b APN 12 4,033,391 (GRCm39) missense probably benign 0.40
IGL02699:Efr3b APN 12 4,033,391 (GRCm39) missense probably benign 0.40
IGL02716:Efr3b APN 12 4,034,627 (GRCm39) missense probably damaging 1.00
IGL02904:Efr3b APN 12 4,034,583 (GRCm39) missense probably damaging 0.99
IGL02986:Efr3b APN 12 4,016,495 (GRCm39) missense probably benign 0.13
IGL03171:Efr3b APN 12 4,018,622 (GRCm39) missense probably benign 0.00
IGL03346:Efr3b APN 12 4,034,648 (GRCm39) missense probably damaging 1.00
PIT4418001:Efr3b UTSW 12 4,030,490 (GRCm39) missense possibly damaging 0.64
R0017:Efr3b UTSW 12 4,043,003 (GRCm39) missense probably damaging 0.98
R0189:Efr3b UTSW 12 4,032,925 (GRCm39) missense probably damaging 1.00
R0361:Efr3b UTSW 12 4,027,923 (GRCm39) missense probably benign 0.00
R0469:Efr3b UTSW 12 4,032,058 (GRCm39) missense probably benign 0.02
R0510:Efr3b UTSW 12 4,032,058 (GRCm39) missense probably benign 0.02
R0782:Efr3b UTSW 12 4,034,686 (GRCm39) splice site probably benign
R2042:Efr3b UTSW 12 4,034,627 (GRCm39) missense probably damaging 1.00
R2359:Efr3b UTSW 12 4,030,136 (GRCm39) unclassified probably benign
R3691:Efr3b UTSW 12 4,032,059 (GRCm39) missense possibly damaging 0.84
R3849:Efr3b UTSW 12 4,033,414 (GRCm39) missense probably benign 0.40
R5384:Efr3b UTSW 12 4,033,419 (GRCm39) missense probably benign 0.04
R5819:Efr3b UTSW 12 4,042,965 (GRCm39) missense probably benign 0.21
R5970:Efr3b UTSW 12 4,018,590 (GRCm39) missense possibly damaging 0.93
R6031:Efr3b UTSW 12 4,017,106 (GRCm39) missense possibly damaging 0.90
R6031:Efr3b UTSW 12 4,017,106 (GRCm39) missense possibly damaging 0.90
R6759:Efr3b UTSW 12 4,034,613 (GRCm39) missense probably damaging 1.00
R6969:Efr3b UTSW 12 4,018,624 (GRCm39) missense probably benign 0.08
R7392:Efr3b UTSW 12 4,019,588 (GRCm39) missense probably benign
R7717:Efr3b UTSW 12 4,034,574 (GRCm39) missense probably damaging 1.00
R8071:Efr3b UTSW 12 4,032,898 (GRCm39) missense probably benign 0.02
R8737:Efr3b UTSW 12 4,049,594 (GRCm39) missense probably damaging 1.00
R8942:Efr3b UTSW 12 4,032,091 (GRCm39) missense possibly damaging 0.74
R9105:Efr3b UTSW 12 4,031,782 (GRCm39) missense probably damaging 1.00
R9345:Efr3b UTSW 12 4,033,409 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGATGTGTCAACTGTATGGC -3'
(R):5'- ACTTGGCACTTGGGAATCATCC -3'

Sequencing Primer
(F):5'- GCAGCAGCCTAGCATATTCC -3'
(R):5'- CTCTCTCCTGGGAAGAACAAGG -3'
Posted On 2021-03-08