Incidental Mutation 'R8686:Lrch3'
ID 662070
Institutional Source Beutler Lab
Gene Symbol Lrch3
Ensembl Gene ENSMUSG00000022801
Gene Name leucine-rich repeats and calponin homology (CH) domain containing 3
Synonyms LOC385628, 2210409B11Rik
MMRRC Submission 068541-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.115) question?
Stock # R8686 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 32734470-32836017 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 32802223 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 58 (V58A)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023491] [ENSMUST00000135193] [ENSMUST00000165616] [ENSMUST00000170899] [ENSMUST00000165826] [ENSMUST00000170201]
AlphaFold Q8BVU0
Predicted Effect probably benign
Transcript: ENSMUST00000023491
AA Change: V426A

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000023491
Gene: ENSMUSG00000022801
AA Change: V426A

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
LRR 104 126 2.54e1 SMART
LRR 127 150 2.86e-1 SMART
LRR 172 194 4.44e0 SMART
LRR 195 218 4.33e1 SMART
LRR 240 263 2.76e1 SMART
low complexity region 482 493 N/A INTRINSIC
low complexity region 539 554 N/A INTRINSIC
CH 651 754 9.24e-15 SMART
low complexity region 759 774 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105610
Predicted Effect probably benign
Transcript: ENSMUST00000135193
AA Change: V426A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000130708
Gene: ENSMUSG00000022801
AA Change: V426A

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
LRR 104 126 2.54e1 SMART
LRR 127 150 2.86e-1 SMART
LRR 172 194 4.44e0 SMART
LRR 195 218 4.33e1 SMART
LRR 240 263 2.76e1 SMART
low complexity region 482 493 N/A INTRINSIC
low complexity region 539 554 N/A INTRINSIC
CH 651 755 6.79e-13 SMART
transmembrane domain 771 793 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142290
SMART Domains Protein: ENSMUSP00000117302
Gene: ENSMUSG00000022801

DomainStartEndE-ValueType
low complexity region 31 42 N/A INTRINSIC
low complexity region 88 103 N/A INTRINSIC
SCOP:d1h67a_ 201 253 1e-11 SMART
Blast:CH 205 253 6e-27 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156928
Predicted Effect possibly damaging
Transcript: ENSMUST00000163428
AA Change: V58A

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000133034
Gene: ENSMUSG00000022801
AA Change: V58A

DomainStartEndE-ValueType
low complexity region 122 137 N/A INTRINSIC
SCOP:d1h67a_ 230 265 9e-5 SMART
Blast:CH 234 265 7e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000165616
AA Change: V272A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000130009
Gene: ENSMUSG00000022801
AA Change: V272A

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
Blast:LRR 89 113 1e-6 BLAST
Blast:LRR 114 137 3e-7 BLAST
low complexity region 328 339 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
CH 497 600 9.24e-15 SMART
low complexity region 605 620 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170899
AA Change: V426A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127547
Gene: ENSMUSG00000022801
AA Change: V426A

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
LRR 104 126 2.54e1 SMART
LRR 127 150 2.86e-1 SMART
LRR 172 194 4.44e0 SMART
LRR 195 218 4.33e1 SMART
LRR 240 263 2.76e1 SMART
low complexity region 489 504 N/A INTRINSIC
CH 565 668 9.24e-15 SMART
low complexity region 673 688 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165826
AA Change: V49A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126308
Gene: ENSMUSG00000022801
AA Change: V49A

DomainStartEndE-ValueType
low complexity region 105 116 N/A INTRINSIC
low complexity region 162 177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170201
AA Change: V426A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126964
Gene: ENSMUSG00000022801
AA Change: V426A

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
LRR 104 126 2.54e1 SMART
LRR 127 150 2.86e-1 SMART
LRR 172 194 4.44e0 SMART
LRR 195 218 4.33e1 SMART
LRR 240 263 2.76e1 SMART
low complexity region 482 493 N/A INTRINSIC
low complexity region 539 554 N/A INTRINSIC
CH 615 718 9.24e-15 SMART
low complexity region 723 738 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 A G 8: 41,208,521 (GRCm39) T596A probably benign Het
Adamts6 A G 13: 104,450,207 (GRCm39) I303V probably damaging Het
Alpl A T 4: 137,471,112 (GRCm39) H341Q probably damaging Het
Cachd1 G A 4: 100,845,325 (GRCm39) R939H probably damaging Het
Cd22 G A 7: 30,569,494 (GRCm39) R541C probably benign Het
Cenpf A T 1: 189,391,801 (GRCm39) M660K probably benign Het
Cmya5 A T 13: 93,231,888 (GRCm39) S1067T possibly damaging Het
Col5a2 C T 1: 45,461,147 (GRCm39) G250D probably damaging Het
Cylc2 C T 4: 51,229,651 (GRCm39) T331M unknown Het
Dgka A G 10: 128,568,962 (GRCm39) M201T probably benign Het
Dnajc13 T C 9: 104,048,004 (GRCm39) I1804V probably benign Het
Dym T A 18: 75,419,754 (GRCm39) Y642N probably damaging Het
Efr3b A T 12: 4,050,886 (GRCm39) D26E probably damaging Het
Emilin1 A T 5: 31,075,040 (GRCm39) K427M possibly damaging Het
Fam187b T C 7: 30,676,659 (GRCm39) L56S probably benign Het
Fbh1 C T 2: 11,760,469 (GRCm39) V694I probably benign Het
Fgd2 C T 17: 29,597,997 (GRCm39) T644I probably benign Het
G6pc1 T G 11: 101,265,533 (GRCm39) probably null Het
Gli2 A G 1: 118,764,417 (GRCm39) S1245P probably benign Het
Gpr137b T C 13: 13,533,991 (GRCm39) Y355C Het
Ighv1-84 T C 12: 115,944,524 (GRCm39) D50G probably benign Het
Impdh1 C A 6: 29,216,214 (GRCm39) probably benign Het
Inhca C T 9: 103,136,627 (GRCm39) A525T probably benign Het
Irf4 A T 13: 30,945,433 (GRCm39) D393V possibly damaging Het
Kalrn A G 16: 34,181,305 (GRCm39) L111P probably damaging Het
Lrif1 C T 3: 106,640,097 (GRCm39) T394I probably damaging Het
Map4k1 A G 7: 28,693,498 (GRCm39) T434A probably benign Het
Mcur1 G A 13: 43,695,193 (GRCm39) T327M probably damaging Het
Myo9b G T 8: 71,786,966 (GRCm39) S716I probably benign Het
Nol10 T A 12: 17,419,772 (GRCm39) probably benign Het
Nos3 A G 5: 24,573,841 (GRCm39) T202A possibly damaging Het
Odad1 A G 7: 45,597,116 (GRCm39) T456A probably benign Het
Or14j7 T C 17: 38,235,168 (GRCm39) V237A probably benign Het
Or2d4 A C 7: 106,543,905 (GRCm39) M101R probably benign Het
Parp12 A T 6: 39,094,856 (GRCm39) S80T probably benign Het
Pde1a C T 2: 79,758,086 (GRCm39) V50I probably benign Het
Pfkl A T 10: 77,833,356 (GRCm39) probably null Het
Phkg1 A T 5: 129,895,056 (GRCm39) Y207N probably damaging Het
Pik3r4 A G 9: 105,535,728 (GRCm39) T640A possibly damaging Het
Pip5k1c C A 10: 81,147,827 (GRCm39) H411N probably damaging Het
Pla2g4e A G 2: 120,075,172 (GRCm39) S73P probably damaging Het
Polr2b T C 5: 77,483,510 (GRCm39) V662A probably damaging Het
Prss43 C T 9: 110,658,494 (GRCm39) R265C possibly damaging Het
Rap1b A T 10: 117,658,746 (GRCm39) V29D probably damaging Het
Rraga A G 4: 86,495,048 (GRCm39) E298G probably damaging Het
Rrp8 A T 7: 105,382,781 (GRCm39) I418N probably damaging Het
Siglecf T C 7: 43,005,030 (GRCm39) V420A probably benign Het
Snx14 T A 9: 88,297,746 (GRCm39) N174I probably damaging Het
Speer4e1 T C 5: 14,984,129 (GRCm39) N229S probably benign Het
Spopfm2 T C 3: 94,083,427 (GRCm39) D128G probably benign Het
Teddm3 A G 16: 20,971,685 (GRCm39) *295Q probably null Het
Tfap2c A G 2: 172,393,926 (GRCm39) D245G possibly damaging Het
Tfap2d A G 1: 19,178,508 (GRCm39) N191S probably benign Het
Tmt1b A T 10: 128,796,476 (GRCm39) M111K possibly damaging Het
Unc80 A G 1: 66,651,427 (GRCm39) R1591G possibly damaging Het
Vmn1r116 T C 7: 20,606,616 (GRCm39) W146R probably damaging Het
Vps13b C G 15: 35,925,535 (GRCm39) S3823R probably damaging Het
Wiz T A 17: 32,586,821 (GRCm39) D163V probably damaging Het
Xylt1 G C 7: 116,980,594 (GRCm39) A61P unknown Het
Zfp521 A C 18: 13,978,701 (GRCm39) F571V probably damaging Het
Zfp664 T A 5: 124,963,133 (GRCm39) C176S possibly damaging Het
Zfyve26 T C 12: 79,334,227 (GRCm39) N264D probably benign Het
Other mutations in Lrch3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Lrch3 APN 16 32,815,335 (GRCm39) missense probably benign 0.10
IGL01400:Lrch3 APN 16 32,799,911 (GRCm39) missense probably damaging 1.00
IGL02565:Lrch3 APN 16 32,826,084 (GRCm39) missense probably benign 0.00
IGL03076:Lrch3 APN 16 32,802,223 (GRCm39) missense possibly damaging 0.52
IGL03103:Lrch3 APN 16 32,772,507 (GRCm39) missense probably damaging 1.00
IGL03125:Lrch3 APN 16 32,734,647 (GRCm39) missense possibly damaging 0.83
IGL03349:Lrch3 APN 16 32,775,694 (GRCm39) missense probably damaging 1.00
eluted UTSW 16 32,806,377 (GRCm39) missense probably null
leached UTSW 16 32,779,833 (GRCm39) missense probably damaging 1.00
R0054:Lrch3 UTSW 16 32,816,222 (GRCm39) intron probably benign
R0123:Lrch3 UTSW 16 32,782,124 (GRCm39) splice site probably benign
R0225:Lrch3 UTSW 16 32,782,124 (GRCm39) splice site probably benign
R0326:Lrch3 UTSW 16 32,799,870 (GRCm39) missense probably damaging 1.00
R0455:Lrch3 UTSW 16 32,807,250 (GRCm39) missense probably damaging 0.99
R0734:Lrch3 UTSW 16 32,817,853 (GRCm39) nonsense probably null
R1204:Lrch3 UTSW 16 32,829,584 (GRCm39) missense probably damaging 1.00
R1470:Lrch3 UTSW 16 32,808,865 (GRCm39) splice site probably benign
R1526:Lrch3 UTSW 16 32,770,746 (GRCm39) missense probably damaging 1.00
R1597:Lrch3 UTSW 16 32,770,781 (GRCm39) nonsense probably null
R1850:Lrch3 UTSW 16 32,807,163 (GRCm39) missense probably benign 0.01
R1966:Lrch3 UTSW 16 32,734,755 (GRCm39) missense possibly damaging 0.94
R2241:Lrch3 UTSW 16 32,816,211 (GRCm39) missense probably damaging 0.99
R2313:Lrch3 UTSW 16 32,782,045 (GRCm39) missense probably damaging 1.00
R2902:Lrch3 UTSW 16 32,770,766 (GRCm39) missense probably damaging 1.00
R4723:Lrch3 UTSW 16 32,808,854 (GRCm39) splice site probably null
R4795:Lrch3 UTSW 16 32,826,074 (GRCm39) missense probably damaging 1.00
R4970:Lrch3 UTSW 16 32,818,883 (GRCm39) missense probably damaging 1.00
R5223:Lrch3 UTSW 16 32,734,767 (GRCm39) missense probably damaging 0.99
R5292:Lrch3 UTSW 16 32,796,177 (GRCm39) missense probably damaging 1.00
R5414:Lrch3 UTSW 16 32,806,335 (GRCm39) splice site probably null
R5470:Lrch3 UTSW 16 32,818,960 (GRCm39) missense probably damaging 1.00
R5594:Lrch3 UTSW 16 32,734,554 (GRCm39) missense probably damaging 0.99
R5843:Lrch3 UTSW 16 32,818,896 (GRCm39) missense probably damaging 1.00
R5862:Lrch3 UTSW 16 32,816,179 (GRCm39) missense probably damaging 1.00
R5911:Lrch3 UTSW 16 32,779,833 (GRCm39) missense probably damaging 1.00
R5932:Lrch3 UTSW 16 32,796,106 (GRCm39) missense probably damaging 1.00
R6519:Lrch3 UTSW 16 32,815,367 (GRCm39) critical splice donor site probably benign
R6731:Lrch3 UTSW 16 32,770,790 (GRCm39) missense probably damaging 1.00
R7182:Lrch3 UTSW 16 32,814,149 (GRCm39) missense probably benign 0.05
R7197:Lrch3 UTSW 16 32,810,665 (GRCm39) missense probably damaging 1.00
R7319:Lrch3 UTSW 16 32,815,363 (GRCm39) missense probably benign 0.19
R7392:Lrch3 UTSW 16 32,807,125 (GRCm39) nonsense probably null
R7408:Lrch3 UTSW 16 32,807,113 (GRCm39) nonsense probably null
R7414:Lrch3 UTSW 16 32,818,883 (GRCm39) missense probably damaging 1.00
R7425:Lrch3 UTSW 16 32,826,077 (GRCm39) missense probably damaging 1.00
R7909:Lrch3 UTSW 16 32,829,663 (GRCm39) missense probably benign 0.00
R7956:Lrch3 UTSW 16 32,806,377 (GRCm39) missense probably null
R8009:Lrch3 UTSW 16 32,826,083 (GRCm39) missense possibly damaging 0.72
R8247:Lrch3 UTSW 16 32,829,713 (GRCm39) nonsense probably null
R8408:Lrch3 UTSW 16 32,775,750 (GRCm39) missense probably damaging 1.00
R8756:Lrch3 UTSW 16 32,808,810 (GRCm39) missense probably benign 0.33
R8947:Lrch3 UTSW 16 32,802,199 (GRCm39) missense possibly damaging 0.66
R9459:Lrch3 UTSW 16 32,799,775 (GRCm39) missense probably damaging 0.99
R9710:Lrch3 UTSW 16 32,796,108 (GRCm39) nonsense probably null
Z1176:Lrch3 UTSW 16 32,734,686 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TAGCCTGGGTGCTCTGAAAC -3'
(R):5'- GGCAGACTGATCTAGTTTAAAATAGCC -3'

Sequencing Primer
(F):5'- TGGGTGCTCTGAAACACTAAGCTC -3'
(R):5'- GCCTTTAAGGTTCACATAAGCC -3'
Posted On 2021-03-08