Incidental Mutation 'R8686:Zfp521'
ID 662075
Institutional Source Beutler Lab
Gene Symbol Zfp521
Ensembl Gene ENSMUSG00000024420
Gene Name zinc finger protein 521
Synonyms B930086A16Rik, Evi3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.940) question?
Stock # R8686 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 13687013-13972733 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 13845644 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Valine at position 571 (F571V)
Ref Sequence ENSEMBL: ENSMUSP00000025288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025288]
AlphaFold Q6KAS7
Predicted Effect probably damaging
Transcript: ENSMUST00000025288
AA Change: F571V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025288
Gene: ENSMUSG00000024420
AA Change: F571V

DomainStartEndE-ValueType
ZnF_C2H2 47 68 3.47e1 SMART
low complexity region 82 100 N/A INTRINSIC
low complexity region 102 113 N/A INTRINSIC
ZnF_C2H2 118 140 3.89e-3 SMART
ZnF_C2H2 146 168 1.33e-1 SMART
ZnF_C2H2 174 196 1.38e-3 SMART
ZnF_C2H2 202 224 2.36e-2 SMART
ZnF_C2H2 246 269 6.57e-1 SMART
ZnF_C2H2 281 304 3.52e-1 SMART
ZnF_C2H2 310 332 1.76e-1 SMART
low complexity region 345 358 N/A INTRINSIC
ZnF_C2H2 405 429 4.34e-1 SMART
ZnF_C2H2 437 460 6.23e-2 SMART
ZnF_C2H2 477 500 8.94e-3 SMART
ZnF_C2H2 513 536 5.42e-2 SMART
ZnF_C2H2 560 585 1.86e0 SMART
ZnF_C2H2 634 656 1.12e-3 SMART
ZnF_C2H2 664 686 2.12e-4 SMART
ZnF_C2H2 694 717 6.42e-4 SMART
ZnF_C2H2 722 745 7.78e-3 SMART
ZnF_C2H2 752 775 6.32e-3 SMART
ZnF_C2H2 783 805 2.05e-2 SMART
ZnF_C2H2 809 832 4.72e-2 SMART
ZnF_C2H2 886 909 1.86e0 SMART
ZnF_C2H2 930 952 3.04e-5 SMART
ZnF_C2H2 959 981 6.42e-4 SMART
ZnF_C2H2 988 1010 7.49e0 SMART
ZnF_C2H2 1020 1042 4.99e1 SMART
Blast:RING 1067 1098 1e-9 BLAST
low complexity region 1099 1119 N/A INTRINSIC
ZnF_C2H2 1138 1161 1.79e-2 SMART
ZnF_C2H2 1195 1217 2.53e-2 SMART
ZnF_C2H2 1225 1247 2.32e-1 SMART
ZnF_C2H2 1256 1279 2.91e-2 SMART
ZnF_C2H2 1286 1309 5.72e-1 SMART
Meta Mutation Damage Score 0.4553 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (58/58)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit postnatal growth retardation, behavioral anomalies including hyperlocomotion, lower anxiety, higher impulsivity and impaired learning, abnormal formation of the neuronal cell layers of the dentate gyrus in the hippocampus, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik C T 9: 103,259,428 A525T probably benign Het
Adam25 A G 8: 40,755,484 T596A probably benign Het
Adamts6 A G 13: 104,313,699 I303V probably damaging Het
Alpl A T 4: 137,743,801 H341Q probably damaging Het
Cachd1 G A 4: 100,988,128 R939H probably damaging Het
Ccdc114 A G 7: 45,947,692 T456A probably benign Het
Cd22 G A 7: 30,870,069 R541C probably benign Het
Cenpf A T 1: 189,659,604 M660K probably benign Het
Cmya5 A T 13: 93,095,380 S1067T possibly damaging Het
Col5a2 C T 1: 45,421,987 G250D probably damaging Het
Cylc2 C T 4: 51,229,651 T331M unknown Het
Dgka A G 10: 128,733,093 M201T probably benign Het
Dnajc13 T C 9: 104,170,805 I1804V probably benign Het
Dym T A 18: 75,286,683 Y642N probably damaging Het
Efr3b A T 12: 4,000,886 D26E probably damaging Het
Emilin1 A T 5: 30,917,696 K427M possibly damaging Het
Fam187b T C 7: 30,977,234 L56S probably benign Het
Fbxo18 C T 2: 11,755,658 V694I probably benign Het
Fgd2 C T 17: 29,379,023 T644I probably benign Het
G6pc T G 11: 101,374,707 probably null Het
Gli2 A G 1: 118,836,687 S1245P probably benign Het
Gm10696 T C 3: 94,176,120 D128G probably benign Het
Gpr137b T C 13: 13,359,406 Y355C Het
Ighv1-84 T C 12: 115,980,904 D50G probably benign Het
Impdh1 C A 6: 29,216,215 probably benign Het
Irf4 A T 13: 30,761,450 D393V possibly damaging Het
Kalrn A G 16: 34,360,935 L111P probably damaging Het
Lrch3 T C 16: 32,981,853 V58A possibly damaging Het
Lrif1 C T 3: 106,732,781 T394I probably damaging Het
Map4k1 A G 7: 28,994,073 T434A probably benign Het
Mcur1 G A 13: 43,541,717 T327M probably damaging Het
Mettl7b A T 10: 128,960,607 M111K possibly damaging Het
Myo9b G T 8: 71,334,322 S716I probably benign Het
Nol10 T A 12: 17,369,771 probably benign Het
Nos3 A G 5: 24,368,843 T202A possibly damaging Het
Olfr128 T C 17: 37,924,277 V237A probably benign Het
Olfr710 A C 7: 106,944,698 M101R probably benign Het
Parp12 A T 6: 39,117,922 S80T probably benign Het
Pde1a C T 2: 79,927,742 V50I probably benign Het
Pfkl A T 10: 77,997,522 probably null Het
Phkg1 A T 5: 129,866,215 Y207N probably damaging Het
Pik3r4 A G 9: 105,658,529 T640A possibly damaging Het
Pip5k1c C A 10: 81,311,993 H411N probably damaging Het
Pla2g4e A G 2: 120,244,691 S73P probably damaging Het
Polr2b T C 5: 77,335,663 V662A probably damaging Het
Prss43 C T 9: 110,829,426 R265C possibly damaging Het
Rap1b A T 10: 117,822,841 V29D probably damaging Het
Rraga A G 4: 86,576,811 E298G probably damaging Het
Rrp8 A T 7: 105,733,574 I418N probably damaging Het
Siglecf T C 7: 43,355,606 V420A probably benign Het
Snx14 T A 9: 88,415,693 N174I probably damaging Het
Speer4e T C 5: 14,934,115 N229S probably benign Het
Teddm3 A G 16: 21,152,935 *295Q probably null Het
Tfap2c A G 2: 172,552,006 D245G possibly damaging Het
Tfap2d A G 1: 19,108,284 N191S probably benign Het
Unc80 A G 1: 66,612,268 R1591G possibly damaging Het
Vmn1r116 T C 7: 20,872,691 W146R probably damaging Het
Vps13b C G 15: 35,925,389 S3823R probably damaging Het
Wiz T A 17: 32,367,847 D163V probably damaging Het
Xylt1 G C 7: 117,381,359 A61P unknown Het
Zfp664 T A 5: 124,886,069 C176S possibly damaging Het
Zfyve26 T C 12: 79,287,453 N264D probably benign Het
Other mutations in Zfp521
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Zfp521 APN 18 13846502 missense probably benign 0.15
IGL00499:Zfp521 APN 18 13939120 missense probably benign 0.25
IGL01291:Zfp521 APN 18 13817246 missense probably damaging 1.00
IGL01335:Zfp521 APN 18 13844719 missense probably benign 0.31
IGL01384:Zfp521 APN 18 13843923 missense probably benign 0.26
IGL01520:Zfp521 APN 18 13938988 missense possibly damaging 0.92
IGL02248:Zfp521 APN 18 13844246 missense possibly damaging 0.93
IGL02640:Zfp521 APN 18 13844930 missense probably benign 0.00
ANU05:Zfp521 UTSW 18 13817246 missense probably damaging 1.00
R0113:Zfp521 UTSW 18 13845091 missense probably damaging 1.00
R0197:Zfp521 UTSW 18 13845062 missense probably benign 0.00
R0457:Zfp521 UTSW 18 13844840 missense probably benign
R0494:Zfp521 UTSW 18 13845268 missense probably damaging 1.00
R0494:Zfp521 UTSW 18 13846870 missense probably damaging 1.00
R0883:Zfp521 UTSW 18 13845062 missense probably benign 0.00
R2133:Zfp521 UTSW 18 13844705 missense possibly damaging 0.88
R2263:Zfp521 UTSW 18 13846240 missense possibly damaging 0.89
R3699:Zfp521 UTSW 18 13846273 nonsense probably null
R3760:Zfp521 UTSW 18 13844629 missense possibly damaging 0.93
R3851:Zfp521 UTSW 18 13717751 splice site probably benign
R3950:Zfp521 UTSW 18 13846346 missense probably damaging 0.99
R4398:Zfp521 UTSW 18 13846544 missense probably benign 0.26
R4583:Zfp521 UTSW 18 13844330 missense probably benign 0.19
R4688:Zfp521 UTSW 18 13844590 missense probably damaging 1.00
R4688:Zfp521 UTSW 18 13844591 nonsense probably null
R4698:Zfp521 UTSW 18 13845603 missense probably damaging 0.96
R4738:Zfp521 UTSW 18 13844054 missense possibly damaging 0.50
R5031:Zfp521 UTSW 18 13844273 missense possibly damaging 0.68
R5137:Zfp521 UTSW 18 13845448 missense probably damaging 1.00
R5257:Zfp521 UTSW 18 13846978 missense probably damaging 1.00
R5420:Zfp521 UTSW 18 13844087 missense probably damaging 1.00
R5917:Zfp521 UTSW 18 13845555 missense probably damaging 0.98
R5995:Zfp521 UTSW 18 13717624 missense probably damaging 1.00
R6088:Zfp521 UTSW 18 13846109 missense possibly damaging 0.47
R6150:Zfp521 UTSW 18 13844078 missense probably damaging 1.00
R6261:Zfp521 UTSW 18 13844627 missense probably damaging 1.00
R7649:Zfp521 UTSW 18 13844356 missense probably damaging 1.00
R7662:Zfp521 UTSW 18 13844116 missense probably damaging 1.00
R7774:Zfp521 UTSW 18 13845781 missense probably benign 0.41
R7935:Zfp521 UTSW 18 13844492 missense probably damaging 1.00
R8225:Zfp521 UTSW 18 13845302 missense probably benign 0.15
R8486:Zfp521 UTSW 18 13846772 missense probably damaging 0.99
R8852:Zfp521 UTSW 18 13939093 missense probably benign 0.11
R8883:Zfp521 UTSW 18 13846080 missense probably damaging 1.00
R8897:Zfp521 UTSW 18 13846080 missense probably damaging 1.00
R8898:Zfp521 UTSW 18 13846080 missense probably damaging 1.00
R8899:Zfp521 UTSW 18 13846080 missense probably damaging 1.00
R8910:Zfp521 UTSW 18 13844176 missense probably benign 0.14
R8959:Zfp521 UTSW 18 13846080 missense probably damaging 1.00
R8980:Zfp521 UTSW 18 13846080 missense probably damaging 1.00
R8989:Zfp521 UTSW 18 13846080 missense probably damaging 1.00
R8990:Zfp521 UTSW 18 13846080 missense probably damaging 1.00
R8991:Zfp521 UTSW 18 13846080 missense probably damaging 1.00
R9276:Zfp521 UTSW 18 13844641 missense probably benign 0.03
R9453:Zfp521 UTSW 18 13844236 missense probably damaging 1.00
R9478:Zfp521 UTSW 18 13817315 missense probably damaging 1.00
R9524:Zfp521 UTSW 18 13847116 missense possibly damaging 0.95
Z1176:Zfp521 UTSW 18 13715163 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGCTGTCTAGGGACGTGTAC -3'
(R):5'- GTCCCCATTGTTACATGGGG -3'

Sequencing Primer
(F):5'- TCTAGGGACGTGTACTTAGCACC -3'
(R):5'- ACATGGGGTTTCTCACTGAC -3'
Posted On 2021-03-08