Incidental Mutation 'R8687:Gm3633'
ID662095
Institutional Source Beutler Lab
Gene Symbol Gm3633
Ensembl Gene ENSMUSG00000095113
Gene Namepredicted gene 3633
Synonyms
Accession Numbers
Is this an essential gene? Not available question?
Stock #R8687 (G1)
Quality Score173.009
Status Not validated
Chromosome14
Chromosomal Location42636467-42641917 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 42640691 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 81 (L81H)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163102]
Predicted Effect
SMART Domains Protein: ENSMUSP00000098262
Gene: ENSMUSG00000095113
AA Change: L81H

DomainStartEndE-ValueType
Pfam:Takusan 57 137 2.9e-26 PFAM
coiled coil region 164 186 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163102
SMART Domains Protein: ENSMUSP00000126330
Gene: ENSMUSG00000095113

DomainStartEndE-ValueType
Pfam:Takusan 1 32 6.1e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 92% (22/24)
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap45 C T 10: 80,016,787 probably benign Het
B3galt4 A G 17: 33,950,845 S140P probably damaging Het
Cog6 C T 3: 52,984,917 V624I probably benign Het
Cysrt1 A G 2: 25,239,387 S38P possibly damaging Het
Eme2 C T 17: 24,894,839 V71M possibly damaging Het
Eva1c C A 16: 90,890,545 T223K probably benign Het
Gm6614 C T 6: 141,994,265 G171S probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Iqch A T 9: 63,524,785 W443R probably damaging Het
Itgb1 T C 8: 128,716,216 V294A probably damaging Het
Kif1b T A 4: 149,261,163 K407* probably null Het
Kyat1 A G 2: 30,185,747 S377P probably benign Het
Mical3 A G 6: 120,959,477 S1363P probably benign Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Naip6 T A 13: 100,299,128 R962S probably benign Het
Pnmal1 T G 7: 16,960,595 V125G probably damaging Het
Ptpdc1 G A 13: 48,586,660 P432S possibly damaging Het
Rhobtb2 G A 14: 69,800,655 T52I probably damaging Het
Spop G A 11: 95,470,511 probably benign Het
Stam CCTGCTGCTGCTGCTGCTGCCGCTGCTGCTGCTG CCTGCCGCTGCTGCTGCTG 2: 14,146,280 probably benign Het
Stam TGCTGCTGCTGCTGCCGCTGCTGCTGCTG TGCTGCTGCTGCTG 2: 14,146,285 probably benign Het
Tmem102 T C 11: 69,804,615 H177R probably benign Het
Trpc4ap T C 2: 155,635,250 T748A possibly damaging Het
Ttc27 T A 17: 74,739,684 Y247N probably benign Het
Ttc39a T C 4: 109,431,579 I292T probably damaging Het
Other mutations in Gm3633
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Gm3633 APN 14 42640638 unclassified probably benign
IGL01640:Gm3633 APN 14 42638367 nonsense probably null
IGL01875:Gm3633 APN 14 42639277 missense probably damaging 1.00
IGL01912:Gm3633 APN 14 42640786 unclassified probably benign
R5039:Gm3633 UTSW 14 42639204 missense possibly damaging 0.78
R6866:Gm3633 UTSW 14 42640622 unclassified probably benign
R8298:Gm3633 UTSW 14 42640718 missense
Predicted Primers PCR Primer
(F):5'- AACAGCCTGGAGTTGTAGCC -3'
(R):5'- AGCCCAACTTGAAGACAGCTATG -3'

Sequencing Primer
(F):5'- CCACCTGTGGTATGAGGGAATC -3'
(R):5'- GATGCACTATCAGGGATTCTCAG -3'
Posted On2021-03-08