Incidental Mutation 'R8721:Suclg1'
ID662115
Institutional Source Beutler Lab
Gene Symbol Suclg1
Ensembl Gene ENSMUSG00000052738
Gene Namesuccinate-CoA ligase, GDP-forming, alpha subunit
SynonymsSucla1, 1500000I01Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8721 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location73248382-73276911 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 73269379 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 218 (L218F)
Ref Sequence ENSEMBL: ENSMUSP00000065113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064740] [ENSMUST00000203632]
Predicted Effect probably damaging
Transcript: ENSMUST00000064740
AA Change: L218F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065113
Gene: ENSMUSG00000052738
AA Change: L218F

DomainStartEndE-ValueType
low complexity region 1 29 N/A INTRINSIC
CoA_binding 51 147 6.28e-35 SMART
Pfam:Succ_CoA_lig 193 336 6.7e-11 PFAM
Pfam:Ligase_CoA 199 324 9.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203632
SMART Domains Protein: ENSMUSP00000145246
Gene: ENSMUSG00000052738

DomainStartEndE-ValueType
low complexity region 1 28 N/A INTRINSIC
PDB:1EUD|A 37 67 2e-12 PDB
SCOP:d1euca1 41 68 6e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha subunit of the heterodimeric enzyme succinate coenzyme A ligase. This enzyme is targeted to the mitochondria and catalyzes the conversion of succinyl CoA and ADP or GDP to succinate and ATP or GTP. Mutations in this gene are the cause of the metabolic disorder fatal infantile lactic acidosis and mitochondrial DNA depletion. [provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik T C 7: 131,277,606 S1785P unknown Het
Abca9 T C 11: 110,144,289 D684G possibly damaging Het
Abhd16a T C 17: 35,091,595 V94A possibly damaging Het
Acly A T 11: 100,521,980 probably null Het
Adamts1 G T 16: 85,797,887 T621K probably damaging Het
Arhgap24 A T 5: 102,875,699 T200S possibly damaging Het
Arhgap31 A G 16: 38,606,696 V598A probably benign Het
Ascc1 T C 10: 60,098,106 F323S possibly damaging Het
Ces2b T A 8: 104,833,895 V114D possibly damaging Het
Cfap73 T C 5: 120,630,024 E223G probably benign Het
Csnk1e T C 15: 79,429,815 N78S possibly damaging Het
Cyp7a1 G T 4: 6,268,273 A484E probably damaging Het
Dnah9 G T 11: 66,095,298 T1170K probably damaging Het
Fam83d G T 2: 158,785,602 V404L probably benign Het
Fbxw28 C T 9: 109,328,314 V289I probably benign Het
Frs2 T G 10: 117,074,030 I476L probably benign Het
Gbp2b A T 3: 142,606,944 I363F possibly damaging Het
Gm8267 A T 14: 44,722,050 F186I possibly damaging Het
Hand1 A G 11: 57,831,779 L3P probably damaging Het
Hmcn2 C T 2: 31,425,177 L3671F probably damaging Het
Hspa12b A G 2: 131,141,002 D260G probably benign Het
Itih2 T C 2: 10,106,808 K440E probably damaging Het
Morn4 A T 19: 42,078,000 N49K possibly damaging Het
Mtmr6 T G 14: 60,289,679 probably null Het
Mylk A T 16: 34,996,806 D1848V probably damaging Het
Myo7b A G 18: 32,007,011 V242A probably damaging Het
Olfr1247 T C 2: 89,609,842 K87E probably benign Het
Olfr27 T G 9: 39,144,090 probably benign Het
Rmdn3 T A 2: 119,139,365 Q405L possibly damaging Het
Robo2 A G 16: 73,906,910 S30P Het
Tas2r134 T C 2: 51,627,559 S17P probably damaging Het
Tdrd9 T C 12: 112,036,455 L846P probably damaging Het
Tgfbi A G 13: 56,625,786 N199S probably benign Het
Traj35 C T 14: 54,183,815 T14I Het
Tril A G 6: 53,820,198 V13A probably benign Het
Tshz2 T A 2: 169,885,358 S625T probably benign Het
Ttll12 A G 15: 83,580,583 F464L probably damaging Het
Wdr35 T C 12: 9,025,044 probably null Het
Zfp346 A G 13: 55,113,678 S94G possibly damaging Het
Zfp429 T A 13: 67,390,212 Y371F probably damaging Het
Zscan4-ps2 A T 7: 11,517,595 E186V probably benign Het
Other mutations in Suclg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01864:Suclg1 APN 6 73264297 intron probably benign
IGL02657:Suclg1 APN 6 73260521 missense probably damaging 1.00
IGL03250:Suclg1 APN 6 73270992 missense probably benign 0.04
IGL03306:Suclg1 APN 6 73270992 missense probably benign 0.04
R0012:Suclg1 UTSW 6 73270997 missense possibly damaging 0.66
R0012:Suclg1 UTSW 6 73270997 missense possibly damaging 0.66
R0038:Suclg1 UTSW 6 73260503 missense probably benign 0.26
R0038:Suclg1 UTSW 6 73260503 missense probably benign 0.26
R0379:Suclg1 UTSW 6 73256228 missense possibly damaging 0.89
R0969:Suclg1 UTSW 6 73271116 missense probably benign 0.33
R1123:Suclg1 UTSW 6 73256227 missense probably benign 0.02
R2089:Suclg1 UTSW 6 73264276 missense probably benign 0.00
R2091:Suclg1 UTSW 6 73264276 missense probably benign 0.00
R2091:Suclg1 UTSW 6 73264276 missense probably benign 0.00
R5083:Suclg1 UTSW 6 73263980 missense probably benign
R6176:Suclg1 UTSW 6 73275343 missense probably damaging 1.00
R6313:Suclg1 UTSW 6 73256209 missense probably damaging 0.97
R6338:Suclg1 UTSW 6 73264246 missense probably damaging 1.00
R7231:Suclg1 UTSW 6 73263971 missense probably benign 0.00
R7246:Suclg1 UTSW 6 73276713 missense unknown
R7250:Suclg1 UTSW 6 73271091 missense probably benign 0.00
R7524:Suclg1 UTSW 6 73263841 missense probably damaging 0.99
R7829:Suclg1 UTSW 6 73275243 splice site probably null
R8166:Suclg1 UTSW 6 73260572 missense probably damaging 1.00
R8735:Suclg1 UTSW 6 73276746 missense unknown
R8799:Suclg1 UTSW 6 73271108 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCTATTGATCTAAGTGGCAAACC -3'
(R):5'- AGAAGCTTTGGGCACAGTGC -3'

Sequencing Primer
(F):5'- CCATGCTGTGAATTGTATACAGTCTG -3'
(R):5'- GTGCACTCTCTTAACCCAGAATC -3'
Posted On2021-03-08