Incidental Mutation 'R8721:Ttll12'
ID662136
Institutional Source Beutler Lab
Gene Symbol Ttll12
Ensembl Gene ENSMUSG00000016757
Gene Nametubulin tyrosine ligase-like family, member 12
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8721 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location83575090-83595157 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83580583 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 464 (F464L)
Ref Sequence ENSEMBL: ENSMUSP00000016901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016901] [ENSMUST00000136066]
Predicted Effect probably damaging
Transcript: ENSMUST00000016901
AA Change: F464L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000016901
Gene: ENSMUSG00000016757
AA Change: F464L

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
Pfam:TTL 341 637 7.4e-78 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136066
SMART Domains Protein: ENSMUSP00000117161
Gene: ENSMUSG00000016757

DomainStartEndE-ValueType
low complexity region 46 60 N/A INTRINSIC
low complexity region 66 79 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik T C 7: 131,277,606 S1785P unknown Het
Abca9 T C 11: 110,144,289 D684G possibly damaging Het
Abhd16a T C 17: 35,091,595 V94A possibly damaging Het
Acly A T 11: 100,521,980 probably null Het
Adamts1 G T 16: 85,797,887 T621K probably damaging Het
Arhgap24 A T 5: 102,875,699 T200S possibly damaging Het
Arhgap31 A G 16: 38,606,696 V598A probably benign Het
Ascc1 T C 10: 60,098,106 F323S possibly damaging Het
Ces2b T A 8: 104,833,895 V114D possibly damaging Het
Cfap73 T C 5: 120,630,024 E223G probably benign Het
Csnk1e T C 15: 79,429,815 N78S possibly damaging Het
Cyp7a1 G T 4: 6,268,273 A484E probably damaging Het
Dnah9 G T 11: 66,095,298 T1170K probably damaging Het
Fam83d G T 2: 158,785,602 V404L probably benign Het
Fbxw28 C T 9: 109,328,314 V289I probably benign Het
Frs2 T G 10: 117,074,030 I476L probably benign Het
Gbp2b A T 3: 142,606,944 I363F possibly damaging Het
Gm8267 A T 14: 44,722,050 F186I possibly damaging Het
Hand1 A G 11: 57,831,779 L3P probably damaging Het
Hmcn2 C T 2: 31,425,177 L3671F probably damaging Het
Hspa12b A G 2: 131,141,002 D260G probably benign Het
Itih2 T C 2: 10,106,808 K440E probably damaging Het
Morn4 A T 19: 42,078,000 N49K possibly damaging Het
Mtmr6 T G 14: 60,289,679 probably null Het
Mylk A T 16: 34,996,806 D1848V probably damaging Het
Myo7b A G 18: 32,007,011 V242A probably damaging Het
Olfr1247 T C 2: 89,609,842 K87E probably benign Het
Olfr27 T G 9: 39,144,090 probably benign Het
Rmdn3 T A 2: 119,139,365 Q405L possibly damaging Het
Robo2 A G 16: 73,906,910 S30P Het
Suclg1 G T 6: 73,269,379 L218F probably damaging Het
Tas2r134 T C 2: 51,627,559 S17P probably damaging Het
Tdrd9 T C 12: 112,036,455 L846P probably damaging Het
Tgfbi A G 13: 56,625,786 N199S probably benign Het
Traj35 C T 14: 54,183,815 T14I Het
Tril A G 6: 53,820,198 V13A probably benign Het
Tshz2 T A 2: 169,885,358 S625T probably benign Het
Wdr35 T C 12: 9,025,044 probably null Het
Zfp346 A G 13: 55,113,678 S94G possibly damaging Het
Zfp429 T A 13: 67,390,212 Y371F probably damaging Het
Zscan4-ps2 A T 7: 11,517,595 E186V probably benign Het
Other mutations in Ttll12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Ttll12 APN 15 83578656 missense probably benign 0.15
IGL00942:Ttll12 APN 15 83582448 missense possibly damaging 0.65
IGL01746:Ttll12 APN 15 83578676 missense probably damaging 1.00
IGL02102:Ttll12 APN 15 83582063 missense probably damaging 1.00
IGL02475:Ttll12 APN 15 83587101 missense probably damaging 1.00
IGL02484:Ttll12 APN 15 83581696 missense possibly damaging 0.94
R0403:Ttll12 UTSW 15 83580658 splice site probably benign
R1477:Ttll12 UTSW 15 83580102 missense probably damaging 1.00
R1530:Ttll12 UTSW 15 83588655 missense probably damaging 1.00
R1925:Ttll12 UTSW 15 83581775 missense probably benign 0.06
R3508:Ttll12 UTSW 15 83580630 missense probably damaging 0.98
R3972:Ttll12 UTSW 15 83582096 missense probably damaging 1.00
R4198:Ttll12 UTSW 15 83577013 missense probably damaging 1.00
R4200:Ttll12 UTSW 15 83577013 missense probably damaging 1.00
R4357:Ttll12 UTSW 15 83581757 missense probably damaging 1.00
R4740:Ttll12 UTSW 15 83580120 missense probably damaging 1.00
R5024:Ttll12 UTSW 15 83587113 missense probably damaging 1.00
R5870:Ttll12 UTSW 15 83577036 missense probably damaging 0.97
R6824:Ttll12 UTSW 15 83591377 critical splice donor site probably null
R7034:Ttll12 UTSW 15 83586885 missense probably benign
R7036:Ttll12 UTSW 15 83586885 missense probably benign
R7447:Ttll12 UTSW 15 83586975 missense probably damaging 1.00
R8496:Ttll12 UTSW 15 83577809 missense probably damaging 1.00
Z1088:Ttll12 UTSW 15 83582078 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATGACGTAACTGAACACTTGAG -3'
(R):5'- CACATGTGGAGTCCTTTTGCG -3'

Sequencing Primer
(F):5'- CTGAACACTTGAGAAGCCGTG -3'
(R):5'- CCTTTTGCGGACACAGGTGAAG -3'
Posted On2021-03-08