Mutagenetix > Incidental Mutation

Incidental Mutation 'R8721:Mylk'

662137

Institutional Source

Beutler Lab

Gene Symbol

Mylk

Ensembl Gene

ENSMUSG00000022836

Gene Name

myosin, light polypeptide kinase

Synonyms

Mlck, telokin, nmMlck, 9530072E15Rik, A930019C19Rik, MLCK108, MLCK210

MMRRC Submission

068717-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8721 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

34565580-34822790 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 34817176 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 1848 (D1848V)

Ref Sequence

ENSEMBL: ENSMUSP00000023538 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023538] [ENSMUST00000231589]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000023538
AA Change: D1848V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000023538
Gene: ENSMUSG00000022836
AA Change: D1848V

Domain	Start	End	E-Value	Type
IGc2	54	122	9.05e-11	SMART
IGc2	177	244	3.94e-11	SMART
Pfam:23ISL	255	409	3.6e-60	PFAM
IGc2	423	491	1.55e-9	SMART
IGc2	523	587	3.32e-18	SMART
IGc2	632	699	6.02e-7	SMART
IGc2	730	798	1.36e-5	SMART
low complexity region	827	844	N/A	INTRINSIC
IGc2	1141	1208	2.42e-11	SMART
low complexity region	1251	1269	N/A	INTRINSIC
IG	1275	1359	4.56e-7	SMART
FN3	1362	1444	2.33e-11	SMART
low complexity region	1457	1479	N/A	INTRINSIC
S_TKc	1495	1750	4.23e-95	SMART
IGc2	1852	1920	5.92e-15	SMART
low complexity region	1934	1950	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000231589
AA Change: D57V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.1%
20x: 96.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a muscle member of the immunoglobulin gene superfamily, encodes myosin light chain kinase which is a calcium/calmodulin dependent enzyme. This kinase phosphorylates myosin regulatory light chains to facilitate myosin interaction with actin filaments to produce contractile activity. This gene encodes both smooth muscle and nonmuscle isoforms. In addition, using a separate promoter in an intron in the 3' region, it encodes telokin, a small protein identical in sequence to the C-terminus of myosin light chain kinase, that is independently expressed in smooth muscle and functions to stabilize unphosphorylated myosin filaments. A pseudogene is located on the p arm of chromosome 3. Four transcript variants that produce four isoforms of the calcium/calmodulin dependent enzyme have been identified as well as two transcripts that produce two isoforms of telokin. Additional variants have been identified but lack full length transcripts. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that lack the isoform abundant in endothelial cells show a reduced susceptibility to acute lung injury. Mice lacking the smooth muscle isoform exhibit partial pre- or neonatal lethality, short small intestine and impaired smooth muscle contraction in the colon. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	T	C	11: 110,035,115 (GRCm39)	D684G	possibly damaging	Het
Abhd16a	T	C	17: 35,310,571 (GRCm39)	V94A	possibly damaging	Het
Acly	A	T	11: 100,412,806 (GRCm39)		probably null	Het
Adamts1	G	T	16: 85,594,775 (GRCm39)	T621K	probably damaging	Het
Arhgap24	A	T	5: 103,023,565 (GRCm39)	T200S	possibly damaging	Het
Arhgap31	A	G	16: 38,427,058 (GRCm39)	V598A	probably benign	Het
Ascc1	T	C	10: 59,933,928 (GRCm39)	F323S	possibly damaging	Het
Cdcp3	T	C	7: 130,879,335 (GRCm39)	S1785P	unknown	Het
Ces2b	T	A	8: 105,560,527 (GRCm39)	V114D	possibly damaging	Het
Cfap73	T	C	5: 120,768,089 (GRCm39)	E223G	probably benign	Het
Csnk1e	T	C	15: 79,314,015 (GRCm39)	N78S	possibly damaging	Het
Cyp7a1	G	T	4: 6,268,273 (GRCm39)	A484E	probably damaging	Het
Dnah9	G	T	11: 65,986,124 (GRCm39)	T1170K	probably damaging	Het
Fam83d	G	T	2: 158,627,522 (GRCm39)	V404L	probably benign	Het
Fbxw28	C	T	9: 109,157,382 (GRCm39)	V289I	probably benign	Het
Frs2	T	G	10: 116,909,935 (GRCm39)	I476L	probably benign	Het
Gbp2b	A	T	3: 142,312,705 (GRCm39)	I363F	possibly damaging	Het
Gm8267	A	T	14: 44,959,507 (GRCm39)	F186I	possibly damaging	Het
Hand1	A	G	11: 57,722,605 (GRCm39)	L3P	probably damaging	Het
Hmcn2	C	T	2: 31,315,189 (GRCm39)	L3671F	probably damaging	Het
Hspa12b	A	G	2: 130,982,922 (GRCm39)	D260G	probably benign	Het
Itih2	T	C	2: 10,111,619 (GRCm39)	K440E	probably damaging	Het
Morn4	A	T	19: 42,066,439 (GRCm39)	N49K	possibly damaging	Het
Mtmr6	T	G	14: 60,527,128 (GRCm39)		probably null	Het
Myo7b	A	G	18: 32,140,064 (GRCm39)	V242A	probably damaging	Het
Or4a74	T	C	2: 89,440,186 (GRCm39)	K87E	probably benign	Het
Or8g19	T	G	9: 39,055,386 (GRCm39)		probably benign	Het
Rmdn3	T	A	2: 118,969,846 (GRCm39)	Q405L	possibly damaging	Het
Robo2	A	G	16: 73,703,798 (GRCm39)	S30P		Het
Suclg1	G	T	6: 73,246,362 (GRCm39)	L218F	probably damaging	Het
Tas2r134	T	C	2: 51,517,571 (GRCm39)	S17P	probably damaging	Het
Tdrd9	T	C	12: 112,002,889 (GRCm39)	L846P	probably damaging	Het
Tgfbi	A	G	13: 56,773,599 (GRCm39)	N199S	probably benign	Het
Traj35	C	T	14: 54,421,272 (GRCm39)	T14I		Het
Tril	A	G	6: 53,797,183 (GRCm39)	V13A	probably benign	Het
Tshz2	T	A	2: 169,727,278 (GRCm39)	S625T	probably benign	Het
Ttll12	A	G	15: 83,464,784 (GRCm39)	F464L	probably damaging	Het
Wdr35	T	C	12: 9,075,044 (GRCm39)		probably null	Het
Zfp346	A	G	13: 55,261,491 (GRCm39)	S94G	possibly damaging	Het
Zfp429	T	A	13: 67,538,331 (GRCm39)	Y371F	probably damaging	Het
Zscan4-ps2	A	T	7: 11,251,522 (GRCm39)	E186V	probably benign	Het

Other mutations in Mylk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01384:Mylk	APN	16	34,759,322 (GRCm39)	missense	probably benign	0.36
IGL01386:Mylk	APN	16	34,791,610 (GRCm39)	critical splice acceptor site	probably null
IGL01684:Mylk	APN	16	34,792,310 (GRCm39)	missense	possibly damaging	0.55
IGL01884:Mylk	APN	16	34,809,247 (GRCm39)	splice site	probably benign
IGL02079:Mylk	APN	16	34,681,001 (GRCm39)	missense	possibly damaging	0.87
IGL02104:Mylk	APN	16	34,635,805 (GRCm39)	missense	probably benign	0.06
IGL02624:Mylk	APN	16	34,750,266 (GRCm39)	missense	probably benign	0.29
IGL02756:Mylk	APN	16	34,784,016 (GRCm39)	missense	probably benign	0.42
IGL02794:Mylk	APN	16	34,806,911 (GRCm39)	missense	probably benign	0.21
IGL02833:Mylk	APN	16	34,735,270 (GRCm39)	missense	probably benign	0.01
IGL02946:Mylk	APN	16	34,742,158 (GRCm39)	missense	probably benign	0.10
IGL03012:Mylk	APN	16	34,773,151 (GRCm39)	missense	probably benign	0.03
IGL03093:Mylk	APN	16	34,732,562 (GRCm39)	missense	possibly damaging	0.62
IGL03272:Mylk	APN	16	34,799,559 (GRCm39)	missense	probably benign	0.09
billy	UTSW	16	34,695,990 (GRCm39)	missense	probably damaging	0.97
brutus	UTSW	16	34,774,065 (GRCm39)	missense	probably benign	0.12
Club	UTSW	16	34,732,645 (GRCm39)	nonsense	probably null
popeye	UTSW	16	34,783,947 (GRCm39)	missense	probably benign	0.29
F5770:Mylk	UTSW	16	34,815,574 (GRCm39)	critical splice donor site	probably null
P4717OSA:Mylk	UTSW	16	34,797,483 (GRCm39)	splice site	probably benign
PIT4382001:Mylk	UTSW	16	34,696,012 (GRCm39)	missense	probably damaging	0.99
R0131:Mylk	UTSW	16	34,695,874 (GRCm39)	missense	probably benign	0.03
R0309:Mylk	UTSW	16	34,732,667 (GRCm39)	splice site	probably benign
R0358:Mylk	UTSW	16	34,699,845 (GRCm39)	missense	possibly damaging	0.74
R0381:Mylk	UTSW	16	34,605,344 (GRCm39)	splice site	probably null
R0390:Mylk	UTSW	16	34,695,990 (GRCm39)	missense	probably damaging	0.97
R0413:Mylk	UTSW	16	34,742,314 (GRCm39)	missense	probably benign	0.01
R0536:Mylk	UTSW	16	34,820,757 (GRCm39)	missense	possibly damaging	0.95
R0544:Mylk	UTSW	16	34,699,845 (GRCm39)	missense	possibly damaging	0.74
R0545:Mylk	UTSW	16	34,699,845 (GRCm39)	missense	possibly damaging	0.74
R0546:Mylk	UTSW	16	34,699,845 (GRCm39)	missense	possibly damaging	0.74
R0547:Mylk	UTSW	16	34,699,845 (GRCm39)	missense	possibly damaging	0.74
R0548:Mylk	UTSW	16	34,699,845 (GRCm39)	missense	possibly damaging	0.74
R0627:Mylk	UTSW	16	34,820,799 (GRCm39)	missense	probably damaging	1.00
R0726:Mylk	UTSW	16	34,699,845 (GRCm39)	missense	possibly damaging	0.74
R0755:Mylk	UTSW	16	34,699,845 (GRCm39)	missense	possibly damaging	0.74
R0782:Mylk	UTSW	16	34,699,845 (GRCm39)	missense	possibly damaging	0.74
R0783:Mylk	UTSW	16	34,699,845 (GRCm39)	missense	possibly damaging	0.74
R0784:Mylk	UTSW	16	34,699,845 (GRCm39)	missense	possibly damaging	0.74
R1136:Mylk	UTSW	16	34,820,688 (GRCm39)	missense	probably damaging	1.00
R1170:Mylk	UTSW	16	34,694,409 (GRCm39)	missense	probably benign	0.20
R1222:Mylk	UTSW	16	34,681,022 (GRCm39)	missense	probably benign	0.12
R1445:Mylk	UTSW	16	34,635,835 (GRCm39)	missense	possibly damaging	0.57
R1583:Mylk	UTSW	16	34,695,956 (GRCm39)	missense	probably benign	0.29
R1618:Mylk	UTSW	16	34,699,845 (GRCm39)	missense	possibly damaging	0.74
R1643:Mylk	UTSW	16	34,696,005 (GRCm39)	missense	probably benign	0.03
R1702:Mylk	UTSW	16	34,742,314 (GRCm39)	missense	probably benign	0.00
R1776:Mylk	UTSW	16	34,773,152 (GRCm39)	missense	probably benign	0.16
R1865:Mylk	UTSW	16	34,732,600 (GRCm39)	missense	probably benign	0.03
R1975:Mylk	UTSW	16	34,700,673 (GRCm39)	splice site	probably null
R2016:Mylk	UTSW	16	34,817,187 (GRCm39)	missense	probably damaging	1.00
R2045:Mylk	UTSW	16	34,774,023 (GRCm39)	missense	probably benign	0.29
R2134:Mylk	UTSW	16	34,806,846 (GRCm39)	missense	probably benign	0.13
R3547:Mylk	UTSW	16	34,700,538 (GRCm39)	missense	possibly damaging	0.61
R3844:Mylk	UTSW	16	34,742,247 (GRCm39)	missense	probably benign	0.01
R4003:Mylk	UTSW	16	34,783,947 (GRCm39)	missense	probably benign	0.29
R4396:Mylk	UTSW	16	34,732,645 (GRCm39)	nonsense	probably null
R4470:Mylk	UTSW	16	34,732,522 (GRCm39)	missense	probably benign	0.09
R4507:Mylk	UTSW	16	34,774,065 (GRCm39)	missense	probably benign	0.12
R4700:Mylk	UTSW	16	34,742,805 (GRCm39)	missense	probably benign	0.16
R4751:Mylk	UTSW	16	34,699,539 (GRCm39)	missense	probably benign	0.29
R4815:Mylk	UTSW	16	34,715,295 (GRCm39)	missense	probably damaging	0.97
R4832:Mylk	UTSW	16	34,742,737 (GRCm39)	missense	probably benign	0.36
R4872:Mylk	UTSW	16	34,735,360 (GRCm39)	missense	possibly damaging	0.89
R4953:Mylk	UTSW	16	34,809,331 (GRCm39)	missense	probably damaging	1.00
R4969:Mylk	UTSW	16	34,791,810 (GRCm39)	missense	probably damaging	0.96
R5009:Mylk	UTSW	16	34,719,877 (GRCm39)	missense	probably benign	0.39
R5130:Mylk	UTSW	16	34,809,367 (GRCm39)	missense	probably damaging	1.00
R5173:Mylk	UTSW	16	34,797,383 (GRCm39)	missense	probably benign	0.40
R5195:Mylk	UTSW	16	34,799,585 (GRCm39)	missense	probably damaging	1.00
R5209:Mylk	UTSW	16	34,742,995 (GRCm39)	missense	possibly damaging	0.55
R5311:Mylk	UTSW	16	34,742,127 (GRCm39)	missense	probably benign	0.01
R5418:Mylk	UTSW	16	34,732,600 (GRCm39)	missense	probably benign	0.02
R5481:Mylk	UTSW	16	34,741,974 (GRCm39)	missense	probably benign	0.09
R5590:Mylk	UTSW	16	34,699,722 (GRCm39)	missense	probably benign	0.29
R5603:Mylk	UTSW	16	34,776,862 (GRCm39)	missense	probably benign	0.06
R5823:Mylk	UTSW	16	34,715,317 (GRCm39)	critical splice donor site	probably null
R6290:Mylk	UTSW	16	34,715,213 (GRCm39)	missense	probably benign	0.39
R6351:Mylk	UTSW	16	34,742,341 (GRCm39)	missense	probably benign	0.01
R6365:Mylk	UTSW	16	34,680,961 (GRCm39)	missense	probably benign	0.12
R6490:Mylk	UTSW	16	34,750,237 (GRCm39)	missense	possibly damaging	0.74
R6723:Mylk	UTSW	16	34,750,258 (GRCm39)	missense	possibly damaging	0.74
R6864:Mylk	UTSW	16	34,694,520 (GRCm39)	missense	probably benign	0.03
R6908:Mylk	UTSW	16	34,700,643 (GRCm39)	missense	probably benign	0.18
R6949:Mylk	UTSW	16	34,820,688 (GRCm39)	missense	probably damaging	1.00
R7018:Mylk	UTSW	16	34,820,796 (GRCm39)	missense	possibly damaging	0.88
R7035:Mylk	UTSW	16	34,797,352 (GRCm39)	missense	possibly damaging	0.89
R7162:Mylk	UTSW	16	34,742,899 (GRCm39)	missense	probably damaging	1.00
R7236:Mylk	UTSW	16	34,742,899 (GRCm39)	missense	probably damaging	1.00
R7269:Mylk	UTSW	16	34,605,381 (GRCm39)	missense	probably damaging	0.96
R7475:Mylk	UTSW	16	34,734,446 (GRCm39)	splice site	probably null
R7525:Mylk	UTSW	16	34,809,357 (GRCm39)	missense	probably benign	0.06
R7587:Mylk	UTSW	16	34,742,887 (GRCm39)	missense	probably benign	0.29
R7607:Mylk	UTSW	16	34,715,184 (GRCm39)	missense	probably benign	0.09
R7616:Mylk	UTSW	16	34,699,927 (GRCm39)	missense	probably damaging	0.97
R7647:Mylk	UTSW	16	34,699,894 (GRCm39)	missense	probably benign	0.29
R7648:Mylk	UTSW	16	34,699,894 (GRCm39)	missense	probably benign	0.29
R7764:Mylk	UTSW	16	34,742,553 (GRCm39)	missense	probably benign	0.16
R7890:Mylk	UTSW	16	34,784,018 (GRCm39)	nonsense	probably null
R7892:Mylk	UTSW	16	34,699,894 (GRCm39)	missense	probably benign	0.29
R7893:Mylk	UTSW	16	34,699,894 (GRCm39)	missense	probably benign	0.29
R8065:Mylk	UTSW	16	34,792,389 (GRCm39)	missense	probably benign	0.08
R8067:Mylk	UTSW	16	34,792,389 (GRCm39)	missense	probably benign	0.08
R8143:Mylk	UTSW	16	34,734,525 (GRCm39)	missense	possibly damaging	0.87
R8210:Mylk	UTSW	16	34,820,721 (GRCm39)	missense	probably damaging	1.00
R8271:Mylk	UTSW	16	34,742,949 (GRCm39)	missense	probably damaging	0.97
R8540:Mylk	UTSW	16	34,750,257 (GRCm39)	missense	possibly damaging	0.87
R8743:Mylk	UTSW	16	34,741,427 (GRCm39)	missense	probably benign	0.03
R8798:Mylk	UTSW	16	34,719,772 (GRCm39)	missense	possibly damaging	0.89
R8956:Mylk	UTSW	16	34,791,779 (GRCm39)	missense	probably benign	0.01
R9131:Mylk	UTSW	16	34,776,835 (GRCm39)	missense	probably benign	0.29
R9403:Mylk	UTSW	16	34,696,012 (GRCm39)	nonsense	probably null
R9624:Mylk	UTSW	16	34,699,677 (GRCm39)	missense	probably benign	0.29
R9735:Mylk	UTSW	16	34,735,179 (GRCm39)	missense	probably benign	0.09
R9756:Mylk	UTSW	16	34,734,387 (GRCm39)	missense	probably damaging	0.96
R9763:Mylk	UTSW	16	34,699,482 (GRCm39)	nonsense	probably null
RF001:Mylk	UTSW	16	34,699,741 (GRCm39)	missense	probably benign	0.03
V7580:Mylk	UTSW	16	34,815,574 (GRCm39)	critical splice donor site	probably null
V7583:Mylk	UTSW	16	34,815,574 (GRCm39)	critical splice donor site	probably null
X0065:Mylk	UTSW	16	34,820,811 (GRCm39)	missense	probably damaging	1.00
Z1177:Mylk	UTSW	16	34,743,021 (GRCm39)	missense	possibly damaging	0.74

Predicted Primers

PCR Primer
(F):5'- TTCACTTCCCTAAGCAGCAC -3'
(R):5'- ACTGGCCCTTTAGGATCAAAGG -3'

Sequencing Primer
(F):5'- ACTTCCCTAAGCAGCACTATTTG -3'
(R):5'- CTGGCCCTTTAGGATCAAAGGTAAAG -3'

Posted On

2021-03-08