Incidental Mutation 'R8722:Ppp1r42'
ID662144
Institutional Source Beutler Lab
Gene Symbol Ppp1r42
Ensembl Gene ENSMUSG00000025916
Gene Nameprotein phosphatase 1, regulatory subunit 42
Synonyms1700011J18Rik, 4930418G15Rik, Lrrc67
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8722 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location9968624-10009136 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 9985669 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 198 (K198R)
Ref Sequence ENSEMBL: ENSMUSP00000027049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027049] [ENSMUST00000124874] [ENSMUST00000130102] [ENSMUST00000176398]
Predicted Effect probably benign
Transcript: ENSMUST00000027049
AA Change: K198R

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000027049
Gene: ENSMUSG00000025916
AA Change: K198R

DomainStartEndE-ValueType
Pfam:LRR_8 50 106 2.5e-8 PFAM
Pfam:LRR_4 72 114 2.3e-11 PFAM
low complexity region 146 164 N/A INTRINSIC
low complexity region 184 201 N/A INTRINSIC
low complexity region 243 259 N/A INTRINSIC
low complexity region 323 332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124874
AA Change: K198R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000115309
Gene: ENSMUSG00000025916
AA Change: K198R

DomainStartEndE-ValueType
Pfam:LRR_8 50 106 2e-8 PFAM
Pfam:LRR_6 71 94 5.9e-3 PFAM
Pfam:LRR_4 72 117 3.8e-11 PFAM
Pfam:LRR_8 72 128 1.3e-8 PFAM
Pfam:LRR_1 73 93 3.4e-3 PFAM
Pfam:LRR_6 145 172 2.2e-3 PFAM
low complexity region 184 201 N/A INTRINSIC
low complexity region 243 259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130102
SMART Domains Protein: ENSMUSP00000115030
Gene: ENSMUSG00000025916

DomainStartEndE-ValueType
Pfam:LRR_6 49 68 4.4e-2 PFAM
Pfam:LRR_8 50 106 2.3e-8 PFAM
Pfam:LRR_6 71 95 6.8e-3 PFAM
Pfam:LRR_4 72 116 6.9e-11 PFAM
Pfam:LRR_8 72 128 1.5e-8 PFAM
Pfam:LRR_1 73 93 5.1e-3 PFAM
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000176398
AA Change: K18R

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000135276
Gene: ENSMUSG00000025916
AA Change: K18R

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
low complexity region 63 79 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.8%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene can interact with gamma-tubulin and PP1 phosphatase, a regulator of centrosome separation. The encoded protein is a positive regulator of PP1 phosphatase and thus plays a role in the control of centrosome integrity. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931422A03Rik A G 2: 103,992,756 C61R probably benign Het
4933427D14Rik A G 11: 72,189,596 F415L probably benign Het
Abcc2 G A 19: 43,836,613 G1446D possibly damaging Het
Acaca A T 11: 84,338,457 E1703D possibly damaging Het
Acap3 T C 4: 155,905,958 *834Q probably null Het
Adam22 A G 5: 8,116,554 S726P probably benign Het
Adamtsl3 T C 7: 82,595,537 probably null Het
Adgrg6 T A 10: 14,420,444 I1071F probably benign Het
Agxt2 A T 15: 10,373,739 D77V probably benign Het
Ahnak C A 19: 9,013,346 S3998* probably null Het
Asns T A 6: 7,676,085 I462F probably damaging Het
Barx2 G C 9: 31,912,984 C36W probably damaging Het
Bnc2 A G 4: 84,293,646 V162A possibly damaging Het
Bptf A G 11: 107,131,469 S152P unknown Het
Brpf3 T C 17: 28,810,536 L490P probably benign Het
Carmil1 T C 13: 24,036,585 D1052G probably benign Het
Cdk17 A G 10: 93,228,703 H311R probably damaging Het
Cenpj G A 14: 56,535,518 R1022C probably damaging Het
Cog5 A G 12: 31,919,704 D741G possibly damaging Het
Csmd2 T A 4: 128,551,950 probably benign Het
Cyr61 T A 3: 145,648,829 N109I probably damaging Het
Dnah17 G A 11: 118,070,457 Q2568* probably null Het
Dspp A G 5: 104,178,567 D932G unknown Het
Dtwd2 T C 18: 49,700,318 T223A probably damaging Het
Fzd8 A G 18: 9,213,686 N256S possibly damaging Het
Gm10800 AAGAAAACTGAAAATCAT A 2: 98,667,034 probably benign Het
Gm9936 T C 5: 114,857,454 Y34C unknown Het
Gstcd T A 3: 133,072,061 K330* probably null Het
Igf2bp1 A G 11: 95,970,780 V277A possibly damaging Het
Kidins220 G A 12: 25,001,594 V332I probably benign Het
Kif24 T C 4: 41,394,233 H1014R probably benign Het
Lrrc43 T C 5: 123,508,079 Y639H possibly damaging Het
Med22 T C 2: 26,910,301 T39A probably benign Het
Morn3 T C 5: 123,041,114 Y91C probably damaging Het
Myo1a T C 10: 127,706,838 M115T probably damaging Het
Olfr1493-ps1 T C 19: 13,726,669 M136T possibly damaging Het
Olfr392 T A 11: 73,815,056 I9F probably benign Het
Olfr667 C T 7: 104,916,501 R265H probably benign Het
Pdcl T C 2: 37,357,305 D24G probably benign Het
Pde10a G A 17: 8,944,940 C250Y probably benign Het
Pla2g10 A T 16: 13,730,390 L8M unknown Het
Plch2 A T 4: 154,985,403 probably benign Het
Prlh G T 1: 90,953,175 R23L possibly damaging Het
Ranbp2 C A 10: 58,476,227 T923K probably damaging Het
Rps11 T C 7: 45,123,192 N65S probably benign Het
Ryr3 T C 2: 112,772,771 T2463A probably benign Het
Shank2 C T 7: 144,175,748 probably benign Het
Slc12a1 T A 2: 125,160,598 V166E probably damaging Het
Slc6a9 C T 4: 117,857,255 R97C unknown Het
Slpi A C 2: 164,356,055 M1R probably null Het
Syne2 T A 12: 75,925,321 V994D probably benign Het
Tacc3 T C 5: 33,668,209 Y435H probably damaging Het
Tpgs2 T A 18: 25,141,622 Q132L probably benign Het
Usp13 T A 3: 32,901,965 I462N probably benign Het
Zfp281 C T 1: 136,625,596 A104V probably benign Het
Zfp40 A G 17: 23,176,183 C477R probably damaging Het
Other mutations in Ppp1r42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01469:Ppp1r42 APN 1 10003233 critical splice donor site probably null
IGL02739:Ppp1r42 APN 1 9968853 missense probably benign 0.34
G1patch:Ppp1r42 UTSW 1 9999507 missense probably damaging 1.00
R0920:Ppp1r42 UTSW 1 9999525 missense probably damaging 1.00
R1829:Ppp1r42 UTSW 1 10000086 missense probably benign 0.00
R2151:Ppp1r42 UTSW 1 10003347 missense probably benign 0.10
R2909:Ppp1r42 UTSW 1 10003412 intron probably benign
R4828:Ppp1r42 UTSW 1 9999411 missense probably benign
R4863:Ppp1r42 UTSW 1 10003386 intron probably benign
R5384:Ppp1r42 UTSW 1 9999435 missense probably damaging 1.00
R5394:Ppp1r42 UTSW 1 9999405 missense probably damaging 1.00
R6725:Ppp1r42 UTSW 1 9999507 missense probably damaging 1.00
R7343:Ppp1r42 UTSW 1 9968857 missense probably benign
R7556:Ppp1r42 UTSW 1 9995183 missense probably benign 0.01
Z1177:Ppp1r42 UTSW 1 9999427 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACCAATTTCTAGGTCCAGATG -3'
(R):5'- CAGCATGGTGATCCCTATTTTGC -3'

Sequencing Primer
(F):5'- TTTCCGAAAGCCTGGTGA -3'
(R):5'- AGCTTCCTCATGACGAGTATAC -3'
Posted On2021-03-08