Mutagenetix > Incidental Mutation

Incidental Mutation 'R8722:Fzd8'

662192

Institutional Source

Beutler Lab

Gene Symbol

Fzd8

Ensembl Gene

ENSMUSG00000036904

Gene Name

frizzled class receptor 8

Synonyms

mFZ8, Fz8

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8722 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

9212856-9216201 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 9213686 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 256 (N256S)

Ref Sequence

ENSEMBL: ENSMUSP00000039660 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041080]

AlphaFold

Q61091

PDB Structure

CRYSTAL STRUCTURE OF THE CYSTEINE-RICH DOMAIN OF MOUSE FRIZZLED 8 (MFZ8) [X-RAY DIFFRACTION]
Crystal structure of XWnt8 in complex with the cysteine-rich domain of Frizzled 8 [X-RAY DIFFRACTION]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000041080
AA Change: N256S

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000039660
Gene: ENSMUSG00000036904
AA Change: N256S

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FRI	34	153	9.06e-73	SMART
low complexity region	161	228	N/A	INTRINSIC
Frizzled	264	621	1.47e-219	SMART
low complexity region	624	655	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 96.8%

Validation Efficiency

100% (54/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene is a member of the frizzled gene family. Members of this family encode seven-transmembrane domain proteins that are receptors for the Wingless type MMTV integration site family of signaling proteins. Most frizzled receptors are coupled to the beta-catenin canonical signaling pathway. This gene is highly expressed in two human cancer cell lines, indicating that it may play a role in several types of cancer. The crystal structure of the extracellular cysteine-rich domain of a similar mouse protein has been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene does not appear to result in a phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931422A03Rik	A	G	2: 103,992,756	C61R	probably benign	Het
4933427D14Rik	A	G	11: 72,189,596	F415L	probably benign	Het
Abcc2	G	A	19: 43,836,613	G1446D	possibly damaging	Het
Acaca	A	T	11: 84,338,457	E1703D	possibly damaging	Het
Acap3	T	C	4: 155,905,958	*834Q	probably null	Het
Adam22	A	G	5: 8,116,554	S726P	probably benign	Het
Adamtsl3	T	C	7: 82,595,537		probably null	Het
Adgrg6	T	A	10: 14,420,444	I1071F	probably benign	Het
Agxt2	A	T	15: 10,373,739	D77V	probably benign	Het
Ahnak	C	A	19: 9,013,346	S3998*	probably null	Het
Asns	T	A	6: 7,676,085	I462F	probably damaging	Het
Barx2	G	C	9: 31,912,984	C36W	probably damaging	Het
Bnc2	A	G	4: 84,293,646	V162A	possibly damaging	Het
Bptf	A	G	11: 107,131,469	S152P	unknown	Het
Brpf3	T	C	17: 28,810,536	L490P	probably benign	Het
Carmil1	T	C	13: 24,036,585	D1052G	probably benign	Het
Cdk17	A	G	10: 93,228,703	H311R	probably damaging	Het
Cenpj	G	A	14: 56,535,518	R1022C	probably damaging	Het
Cog5	A	G	12: 31,919,704	D741G	possibly damaging	Het
Csmd2	T	A	4: 128,551,950		probably benign	Het
Cyr61	T	A	3: 145,648,829	N109I	probably damaging	Het
Dnah17	G	A	11: 118,070,457	Q2568*	probably null	Het
Dspp	A	G	5: 104,178,567	D932G	unknown	Het
Dtwd2	T	C	18: 49,700,318	T223A	probably damaging	Het
Gm10800	AAGAAAACTGAAAATCAT	A	2: 98,667,034		probably benign	Het
Gm9936	T	C	5: 114,857,454	Y34C	unknown	Het
Gstcd	T	A	3: 133,072,061	K330*	probably null	Het
Igf2bp1	A	G	11: 95,970,780	V277A	possibly damaging	Het
Kidins220	G	A	12: 25,001,594	V332I	probably benign	Het
Kif24	T	C	4: 41,394,233	H1014R	probably benign	Het
Lrrc43	T	C	5: 123,508,079	Y639H	possibly damaging	Het
Med22	T	C	2: 26,910,301	T39A	probably benign	Het
Morn3	T	C	5: 123,041,114	Y91C	probably damaging	Het
Myo1a	T	C	10: 127,706,838	M115T	probably damaging	Het
Olfr1493-ps1	T	C	19: 13,726,669	M136T	possibly damaging	Het
Olfr392	T	A	11: 73,815,056	I9F	probably benign	Het
Olfr667	C	T	7: 104,916,501	R265H	probably benign	Het
Pdcl	T	C	2: 37,357,305	D24G	probably benign	Het
Pde10a	G	A	17: 8,944,940	C250Y	probably benign	Het
Pla2g10	A	T	16: 13,730,390	L8M	unknown	Het
Plch2	A	T	4: 154,985,403		probably benign	Het
Ppp1r42	T	C	1: 9,985,669	K198R	probably benign	Het
Prlh	G	T	1: 90,953,175	R23L	possibly damaging	Het
Ranbp2	C	A	10: 58,476,227	T923K	probably damaging	Het
Rps11	T	C	7: 45,123,192	N65S	probably benign	Het
Ryr3	T	C	2: 112,772,771	T2463A	probably benign	Het
Shank2	C	T	7: 144,175,748		probably benign	Het
Slc12a1	T	A	2: 125,160,598	V166E	probably damaging	Het
Slc6a9	C	T	4: 117,857,255	R97C	unknown	Het
Slpi	A	C	2: 164,356,055	M1R	probably null	Het
Syne2	T	A	12: 75,925,321	V994D	probably benign	Het
Tacc3	T	C	5: 33,668,209	Y435H	probably damaging	Het
Tpgs2	T	A	18: 25,141,622	Q132L	probably benign	Het
Usp13	T	A	3: 32,901,965	I462N	probably benign	Het
Zfp281	C	T	1: 136,625,596	A104V	probably benign	Het
Zfp40	A	G	17: 23,176,183	C477R	probably damaging	Het

Other mutations in Fzd8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00571:Fzd8	APN	18	9213068	missense	unknown
IGL01511:Fzd8	APN	18	9213293	missense	unknown
IGL03129:Fzd8	APN	18	9214270	missense	probably damaging	1.00
Stilt	UTSW	18	9213880	missense	probably damaging	1.00
R0058:Fzd8	UTSW	18	9213985	missense	possibly damaging	0.92
R0715:Fzd8	UTSW	18	9212947	missense	unknown
R0966:Fzd8	UTSW	18	9214745	missense	probably damaging	0.99
R1717:Fzd8	UTSW	18	9214364	missense	probably damaging	1.00
R1751:Fzd8	UTSW	18	9213643	missense	probably damaging	0.98
R1761:Fzd8	UTSW	18	9213643	missense	probably damaging	0.98
R1905:Fzd8	UTSW	18	9213803	missense	probably damaging	1.00
R1956:Fzd8	UTSW	18	9214502	missense	probably damaging	1.00
R2892:Fzd8	UTSW	18	9214514	missense	probably damaging	1.00
R3897:Fzd8	UTSW	18	9214939	missense	possibly damaging	0.89
R3968:Fzd8	UTSW	18	9214070	missense	probably damaging	0.98
R4934:Fzd8	UTSW	18	9214492	frame shift	probably null
R5366:Fzd8	UTSW	18	9213880	missense	probably damaging	1.00
R5624:Fzd8	UTSW	18	9213268	missense	unknown
R6261:Fzd8	UTSW	18	9214598	missense	possibly damaging	0.61
R6757:Fzd8	UTSW	18	9213238	missense	possibly damaging	0.78
R6758:Fzd8	UTSW	18	9213238	missense	possibly damaging	0.78
R6899:Fzd8	UTSW	18	9214729	missense	probably damaging	0.98
R7242:Fzd8	UTSW	18	9214171	missense	probably damaging	1.00
R8140:Fzd8	UTSW	18	9213797	missense	probably damaging	1.00
R8324:Fzd8	UTSW	18	9214688	missense	probably damaging	1.00
R8818:Fzd8	UTSW	18	9214474	missense	probably benign	0.26
R8820:Fzd8	UTSW	18	9213247	missense	unknown
R8913:Fzd8	UTSW	18	9213869	missense	probably damaging	1.00
R9036:Fzd8	UTSW	18	9214661	missense	probably damaging	1.00
R9401:Fzd8	UTSW	18	9213205	missense	possibly damaging	0.78

Predicted Primers

PCR Primer
(F):5'- CTCTGTGCATGGACTACAACC -3'
(R):5'- AATATGATGGGCCGTTCCG -3'

Sequencing Primer
(F):5'- TGGACTACAACCGCACCG -3'
(R):5'- GGGTACTTAAAGCGCTCCATATCG -3'

Posted On

2021-03-08