Incidental Mutation 'R8723:Cnot1'
ID 662228
Institutional Source Beutler Lab
Gene Symbol Cnot1
Ensembl Gene ENSMUSG00000036550
Gene Name CCR4-NOT transcription complex, subunit 1
Synonyms 6030411K04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8723 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 95719451-95807464 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 95736279 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 1651 (I1651T)
Ref Sequence ENSEMBL: ENSMUSP00000063565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000211887] [ENSMUST00000213006]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000068452
AA Change: I1651T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550
AA Change: I1651T

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
PDB:4J8S|A 798 999 1e-137 PDB
low complexity region 1011 1028 N/A INTRINSIC
low complexity region 1031 1055 N/A INTRINSIC
PDB:4CT4|C 1056 1295 1e-148 PDB
low complexity region 1296 1308 N/A INTRINSIC
low complexity region 1328 1345 N/A INTRINSIC
Pfam:DUF3819 1381 1530 2.5e-56 PFAM
low complexity region 1634 1648 N/A INTRINSIC
Pfam:Not1 1991 2305 2.4e-125 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098473
AA Change: I1656T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550
AA Change: I1656T

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
Pfam:CNOT1_HEAT 500 656 2.4e-57 PFAM
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
Pfam:CNOT1_TTP_bind 812 1004 1.4e-87 PFAM
low complexity region 1016 1033 N/A INTRINSIC
low complexity region 1036 1060 N/A INTRINSIC
Pfam:CNOT1_CAF1_bind 1087 1313 5.7e-99 PFAM
low complexity region 1333 1350 N/A INTRINSIC
Pfam:DUF3819 1387 1534 2.3e-57 PFAM
low complexity region 1639 1653 N/A INTRINSIC
Pfam:Not1 1998 2357 5.7e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211887
AA Change: I1649T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000213006
Meta Mutation Damage Score 0.0677 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (55/55)
MGI Phenotype PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,105,691 Y122H probably damaging Het
Abca12 A T 1: 71,321,738 H465Q probably benign Het
Adam29 T C 8: 55,871,478 H647R probably damaging Het
Adamtsl4 C T 3: 95,677,116 R990Q possibly damaging Het
Adgrg7 T G 16: 56,761,919 R285S probably benign Het
Alkbh1 A G 12: 87,438,508 V115A probably benign Het
Ankrd50 A C 3: 38,457,304 F305V probably damaging Het
Anpep A G 7: 79,838,938 S414P probably damaging Het
Anxa3 A G 5: 96,838,347 I282V probably benign Het
Aoah T G 13: 21,000,010 Y415D possibly damaging Het
Cacna1b A G 2: 24,658,498 V1188A probably damaging Het
Col6a3 C G 1: 90,767,606 probably benign Het
Ctnnd1 G A 2: 84,620,040 P279S probably benign Het
Dnah10 A T 5: 124,814,621 E3298V probably damaging Het
Ear14 C T 14: 51,204,056 T123I possibly damaging Het
Elf3 A G 1: 135,257,647 L43P possibly damaging Het
Exoc3l4 T A 12: 111,430,658 probably benign Het
Figla A G 6: 86,020,742 T151A probably benign Het
Fsd1l A G 4: 53,647,001 E56G unknown Het
Gm49359 A T 13: 62,454,596 H263Q probably damaging Het
Gprc6a A T 10: 51,615,422 C744S probably damaging Het
Grhl1 G A 12: 24,612,245 probably benign Het
Gtf2h5 C CA 17: 6,084,558 probably null Het
Itih3 T A 14: 30,908,804 Q850L probably damaging Het
Kcnq5 A G 1: 21,505,367 V285A probably damaging Het
Klc4 T G 17: 46,640,700 E165A probably benign Het
Lrp2 T C 2: 69,486,304 Y2111C probably damaging Het
Lyst A G 13: 13,712,757 E3057G possibly damaging Het
Macf1 G A 4: 123,455,117 Q4006* probably null Het
Map4k1 G A 7: 28,987,117 D155N probably damaging Het
Myh14 A G 7: 44,622,983 F1466S probably damaging Het
Nrip1 T C 16: 76,292,665 D668G probably damaging Het
Olfr1047 A T 2: 86,228,442 H176Q probably damaging Het
Olfr1141 T C 2: 87,753,157 T279A possibly damaging Het
P2rx1 C A 11: 73,008,930 N120K probably benign Het
Pif1 T A 9: 65,594,391 M569K probably damaging Het
Prkd2 G A 7: 16,857,777 V578I possibly damaging Het
Rhobtb1 A G 10: 69,270,271 Y284C probably damaging Het
Rps6kb1 T C 11: 86,519,931 T164A possibly damaging Het
Rxfp1 T C 3: 79,650,495 T559A probably benign Het
Sag G A 1: 87,823,453 probably null Het
Smoc1 G A 12: 81,135,812 V138I possibly damaging Het
Spag5 T A 11: 78,321,389 I1081N probably damaging Het
Stk25 A G 1: 93,625,944 I203T probably damaging Het
Strip2 T A 6: 29,941,864 V611E probably damaging Het
Sulf1 A T 1: 12,786,687 D54V probably damaging Het
Tacr2 A G 10: 62,258,328 D188G probably damaging Het
Tmem237 A T 1: 59,106,572 Y358N probably damaging Het
Trim27 A C 13: 21,190,637 probably benign Het
Tsen34 A G 7: 3,695,150 E139G probably benign Het
Ttc39a T A 4: 109,443,503 probably benign Het
Tubgcp3 A T 8: 12,621,899 I781N probably damaging Het
Uqcc1 C T 2: 155,887,180 W21* probably null Het
Vmn2r117 A T 17: 23,477,369 W355R probably damaging Het
Vmn2r89 T C 14: 51,456,453 V420A probably benign Het
Zdhhc21 A T 4: 82,844,202 I52K probably benign Het
Other mutations in Cnot1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Cnot1 APN 8 95726079 missense probably damaging 1.00
IGL01340:Cnot1 APN 8 95760537 missense probably damaging 1.00
IGL01457:Cnot1 APN 8 95741009 missense probably damaging 1.00
IGL01505:Cnot1 APN 8 95728718 missense probably damaging 0.98
IGL02401:Cnot1 APN 8 95756133 missense possibly damaging 0.95
IGL02693:Cnot1 APN 8 95773485 missense probably damaging 1.00
IGL02696:Cnot1 APN 8 95745017 missense probably benign 0.00
IGL02754:Cnot1 APN 8 95755078 missense probably benign 0.03
IGL03092:Cnot1 APN 8 95769615 intron probably benign
IGL03174:Cnot1 APN 8 95761355 missense probably damaging 1.00
IGL03310:Cnot1 APN 8 95735680 splice site probably benign
IGL03371:Cnot1 APN 8 95774716 missense possibly damaging 0.85
Affiliate UTSW 8 95765125 missense probably damaging 0.99
Barge UTSW 8 95734129 missense probably benign 0.13
Byproduct UTSW 8 95745647 frame shift probably null
Chairman UTSW 8 95765027 missense possibly damaging 0.95
cohort UTSW 8 95735749 missense probably damaging 0.99
Director UTSW 8 95765062 missense probably benign 0.15
kowloon UTSW 8 95788658 missense probably damaging 1.00
Quorum UTSW 8 95726118 missense probably damaging 1.00
tugboat UTSW 8 95773618 missense probably damaging 0.99
Xiao UTSW 8 95730420 missense probably damaging 1.00
BB001:Cnot1 UTSW 8 95745647 frame shift probably null
BB003:Cnot1 UTSW 8 95745647 frame shift probably null
BB011:Cnot1 UTSW 8 95745647 frame shift probably null
BB013:Cnot1 UTSW 8 95745647 frame shift probably null
R0008:Cnot1 UTSW 8 95761341 missense probably damaging 1.00
R0008:Cnot1 UTSW 8 95761341 missense probably damaging 1.00
R0091:Cnot1 UTSW 8 95763144 missense probably damaging 1.00
R0335:Cnot1 UTSW 8 95772000 missense probably benign 0.02
R0409:Cnot1 UTSW 8 95748855 missense probably damaging 0.96
R0445:Cnot1 UTSW 8 95760208 missense probably damaging 1.00
R1505:Cnot1 UTSW 8 95728667 missense probably damaging 1.00
R1517:Cnot1 UTSW 8 95743213 missense probably benign 0.38
R1640:Cnot1 UTSW 8 95769832 missense probably damaging 0.98
R1737:Cnot1 UTSW 8 95748276 missense probably damaging 0.98
R1755:Cnot1 UTSW 8 95724577 missense probably damaging 1.00
R1901:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1902:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1903:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1988:Cnot1 UTSW 8 95741944 missense possibly damaging 0.89
R2051:Cnot1 UTSW 8 95724593 missense possibly damaging 0.47
R2054:Cnot1 UTSW 8 95739841 missense possibly damaging 0.55
R2072:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2074:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2075:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2093:Cnot1 UTSW 8 95775358 missense probably damaging 1.00
R2116:Cnot1 UTSW 8 95726153 missense probably damaging 1.00
R2191:Cnot1 UTSW 8 95761426 missense probably damaging 0.98
R2238:Cnot1 UTSW 8 95769521 missense probably benign 0.04
R2239:Cnot1 UTSW 8 95769521 missense probably benign 0.04
R2251:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2252:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2253:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2315:Cnot1 UTSW 8 95749062 missense probably damaging 1.00
R2431:Cnot1 UTSW 8 95774652 missense probably damaging 1.00
R2988:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R2989:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3108:Cnot1 UTSW 8 95735749 missense probably damaging 0.99
R3109:Cnot1 UTSW 8 95735749 missense probably damaging 0.99
R3114:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3115:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3153:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3154:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R4112:Cnot1 UTSW 8 95773618 missense probably damaging 0.99
R4359:Cnot1 UTSW 8 95739848 missense probably damaging 1.00
R4382:Cnot1 UTSW 8 95769779 missense probably damaging 0.97
R4747:Cnot1 UTSW 8 95774682 missense probably benign 0.27
R4910:Cnot1 UTSW 8 95733231 missense probably benign 0.43
R4913:Cnot1 UTSW 8 95763067 missense possibly damaging 0.63
R4971:Cnot1 UTSW 8 95721626 missense probably damaging 1.00
R5056:Cnot1 UTSW 8 95741008 missense probably damaging 1.00
R5092:Cnot1 UTSW 8 95752768 missense possibly damaging 0.91
R5101:Cnot1 UTSW 8 95760187 missense possibly damaging 0.90
R5498:Cnot1 UTSW 8 95757355 missense possibly damaging 0.92
R5719:Cnot1 UTSW 8 95744296 missense possibly damaging 0.92
R5850:Cnot1 UTSW 8 95734147 nonsense probably null
R5956:Cnot1 UTSW 8 95754978 critical splice donor site probably null
R5981:Cnot1 UTSW 8 95788665 missense probably damaging 1.00
R6093:Cnot1 UTSW 8 95748894 missense probably benign 0.03
R6108:Cnot1 UTSW 8 95730420 missense probably damaging 1.00
R6261:Cnot1 UTSW 8 95741921 missense probably benign 0.00
R6632:Cnot1 UTSW 8 95773267 intron probably benign
R6882:Cnot1 UTSW 8 95720426 missense possibly damaging 0.85
R6966:Cnot1 UTSW 8 95724532 missense probably damaging 1.00
R6985:Cnot1 UTSW 8 95734129 missense probably benign 0.13
R7210:Cnot1 UTSW 8 95788658 missense probably damaging 1.00
R7410:Cnot1 UTSW 8 95733159 missense possibly damaging 0.77
R7623:Cnot1 UTSW 8 95727648 missense probably damaging 1.00
R7624:Cnot1 UTSW 8 95751819 missense probably damaging 1.00
R7695:Cnot1 UTSW 8 95770632 missense probably benign 0.03
R7703:Cnot1 UTSW 8 95760098 critical splice donor site probably null
R7771:Cnot1 UTSW 8 95765125 missense probably damaging 0.99
R7800:Cnot1 UTSW 8 95765062 missense probably benign 0.15
R7809:Cnot1 UTSW 8 95751778 missense probably damaging 1.00
R7857:Cnot1 UTSW 8 95745647 frame shift probably null
R7914:Cnot1 UTSW 8 95745647 frame shift probably null
R7924:Cnot1 UTSW 8 95745647 frame shift probably null
R7926:Cnot1 UTSW 8 95745647 frame shift probably null
R7981:Cnot1 UTSW 8 95763169 missense probably damaging 1.00
R8004:Cnot1 UTSW 8 95752752 missense probably benign 0.03
R8061:Cnot1 UTSW 8 95765027 missense possibly damaging 0.95
R8185:Cnot1 UTSW 8 95761351 missense probably damaging 1.00
R8269:Cnot1 UTSW 8 95751761 missense probably damaging 1.00
R8306:Cnot1 UTSW 8 95747021 missense probably benign 0.05
R8322:Cnot1 UTSW 8 95769844 missense probably benign 0.00
R8427:Cnot1 UTSW 8 95734324 missense probably benign 0.01
R8934:Cnot1 UTSW 8 95765067 missense probably benign 0.04
R9025:Cnot1 UTSW 8 95749032 missense probably benign
R9179:Cnot1 UTSW 8 95773426 missense probably benign 0.16
R9280:Cnot1 UTSW 8 95770599 missense probably benign 0.15
R9285:Cnot1 UTSW 8 95726118 missense probably damaging 1.00
R9299:Cnot1 UTSW 8 95741820 missense probably damaging 1.00
R9337:Cnot1 UTSW 8 95741820 missense probably damaging 1.00
R9480:Cnot1 UTSW 8 95770710 missense possibly damaging 0.94
R9548:Cnot1 UTSW 8 95756226 missense probably benign 0.02
R9601:Cnot1 UTSW 8 95756207 missense probably benign 0.02
R9629:Cnot1 UTSW 8 95729246 missense probably damaging 0.98
R9752:Cnot1 UTSW 8 95761391 missense probably damaging 1.00
R9764:Cnot1 UTSW 8 95769581 missense probably benign 0.00
R9789:Cnot1 UTSW 8 95729144 missense probably damaging 1.00
X0050:Cnot1 UTSW 8 95743098 splice site probably null
Z1176:Cnot1 UTSW 8 95748277 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- GGGTGGGAATCAACAATACTTG -3'
(R):5'- TTGTGCCCGTGAACAACCTTAAG -3'

Sequencing Primer
(F):5'- GTGGGAATCAACAATACTTGGTTTGC -3'
(R):5'- CCCGTGAACAACCTTAAGAATGTTTG -3'
Posted On 2021-03-08