Incidental Mutation 'R8723:Gprc6a'
ID662230
Institutional Source Beutler Lab
Gene Symbol Gprc6a
Ensembl Gene ENSMUSG00000019905
Gene NameG protein-coupled receptor, family C, group 6, member A
Synonyms
Accession Numbers

Ncbi RefSeq: NM_153071.1; MGI:2429498

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8723 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location51614823-51631461 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 51615422 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 744 (C744S)
Ref Sequence ENSEMBL: ENSMUSP00000020062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020062] [ENSMUST00000218684] [ENSMUST00000219286]
Predicted Effect probably damaging
Transcript: ENSMUST00000020062
AA Change: C744S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020062
Gene: ENSMUSG00000019905
AA Change: C744S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 73 482 2.3e-62 PFAM
Pfam:NCD3G 519 572 5.9e-18 PFAM
Pfam:7tm_3 600 838 2e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000218684
AA Change: C569S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000219286
AA Change: C673S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype Strain: 3831176
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of family C of the G protein-coupled receptor (GPCR) superfamily, such as GPRC6A, are characterized by an evolutionarily conserved amino acid-sensing motif linked to an intramembranous 7-transmembrane loop region. Several members of GPCR family C, including GPRC6A, also have a long N-terminal domain (summary by Pi et al., 2005 [PubMed 16199532]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show a metabolic syndrome characterized by impaired bone mineralization, increased fat mass, abnormal renal handling of calcium and phosphorus, fatty liver, glucose intolerance, testicular feminization and abnormal steroidogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,105,691 Y122H probably damaging Het
Abca12 A T 1: 71,321,738 H465Q probably benign Het
Adam29 T C 8: 55,871,478 H647R probably damaging Het
Adamtsl4 C T 3: 95,677,116 R990Q possibly damaging Het
Adgrg7 T G 16: 56,761,919 R285S probably benign Het
Alkbh1 A G 12: 87,438,508 V115A probably benign Het
Ankrd50 A C 3: 38,457,304 F305V probably damaging Het
Anpep A G 7: 79,838,938 S414P probably damaging Het
Anxa3 A G 5: 96,838,347 I282V probably benign Het
Aoah T G 13: 21,000,010 Y415D possibly damaging Het
Cacna1b A G 2: 24,658,498 V1188A probably damaging Het
Cnot1 A G 8: 95,736,279 I1651T probably benign Het
Col6a3 C G 1: 90,767,606 probably benign Het
Ctnnd1 G A 2: 84,620,040 P279S probably benign Het
Dnah10 A T 5: 124,814,621 E3298V probably damaging Het
Ear14 C T 14: 51,204,056 T123I possibly damaging Het
Elf3 A G 1: 135,257,647 L43P possibly damaging Het
Figla A G 6: 86,020,742 T151A probably benign Het
Gm49359 A T 13: 62,454,596 H263Q probably damaging Het
Gtf2h5 C CA 17: 6,084,558 probably null Het
Itih3 T A 14: 30,908,804 Q850L probably damaging Het
Kcnq5 A G 1: 21,505,367 V285A probably damaging Het
Klc4 T G 17: 46,640,700 E165A probably benign Het
Lrp2 T C 2: 69,486,304 Y2111C probably damaging Het
Lyst A G 13: 13,712,757 E3057G possibly damaging Het
Macf1 G A 4: 123,455,117 Q4006* probably null Het
Map4k1 G A 7: 28,987,117 D155N probably damaging Het
Myh14 A G 7: 44,622,983 F1466S probably damaging Het
Nrip1 T C 16: 76,292,665 D668G probably damaging Het
Olfr1047 A T 2: 86,228,442 H176Q probably damaging Het
Olfr1141 T C 2: 87,753,157 T279A possibly damaging Het
P2rx1 C A 11: 73,008,930 N120K probably benign Het
Pif1 T A 9: 65,594,391 M569K probably damaging Het
Prkd2 G A 7: 16,857,777 V578I possibly damaging Het
Rhobtb1 A G 10: 69,270,271 Y284C probably damaging Het
Rps6kb1 T C 11: 86,519,931 T164A possibly damaging Het
Rxfp1 T C 3: 79,650,495 T559A probably benign Het
Sag G A 1: 87,823,453 probably null Het
Smoc1 G A 12: 81,135,812 V138I possibly damaging Het
Spag5 T A 11: 78,321,389 I1081N probably damaging Het
Stk25 A G 1: 93,625,944 I203T probably damaging Het
Strip2 T A 6: 29,941,864 V611E probably damaging Het
Sulf1 A T 1: 12,786,687 D54V probably damaging Het
Tacr2 A G 10: 62,258,328 D188G probably damaging Het
Tmem237 A T 1: 59,106,572 Y358N probably damaging Het
Tsen34 A G 7: 3,695,150 E139G probably benign Het
Tubgcp3 A T 8: 12,621,899 I781N probably damaging Het
Uqcc1 C T 2: 155,887,180 W21* probably null Het
Vmn2r117 A T 17: 23,477,369 W355R probably damaging Het
Vmn2r89 T C 14: 51,456,453 V420A probably benign Het
Zdhhc21 A T 4: 82,844,202 I52K probably benign Het
Other mutations in Gprc6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Gprc6a APN 10 51615430 missense probably damaging 1.00
IGL01640:Gprc6a APN 10 51627084 missense probably damaging 0.99
IGL02122:Gprc6a APN 10 51626723 missense probably benign
IGL02317:Gprc6a APN 10 51620953 missense probably benign 0.01
IGL02995:Gprc6a APN 10 51626799 missense probably damaging 1.00
IGL03229:Gprc6a APN 10 51616603 missense probably damaging 1.00
IGL03256:Gprc6a APN 10 51628349 missense possibly damaging 0.77
IGL03290:Gprc6a APN 10 51615872 missense probably damaging 1.00
IGL03393:Gprc6a APN 10 51615259 missense probably damaging 1.00
R0040:Gprc6a UTSW 10 51614984 nonsense probably null
R0040:Gprc6a UTSW 10 51614984 nonsense probably null
R0050:Gprc6a UTSW 10 51615389 missense probably damaging 1.00
R0050:Gprc6a UTSW 10 51615389 missense probably damaging 1.00
R1495:Gprc6a UTSW 10 51628437 missense probably benign 0.01
R1831:Gprc6a UTSW 10 51615806 missense probably benign 0.22
R2108:Gprc6a UTSW 10 51615208 missense probably damaging 1.00
R2159:Gprc6a UTSW 10 51615680 frame shift probably null
R2160:Gprc6a UTSW 10 51615680 frame shift probably null
R2162:Gprc6a UTSW 10 51615680 frame shift probably null
R2229:Gprc6a UTSW 10 51626795 missense possibly damaging 0.50
R3009:Gprc6a UTSW 10 51628296 missense probably benign 0.02
R3709:Gprc6a UTSW 10 51615680 frame shift probably null
R3710:Gprc6a UTSW 10 51615680 frame shift probably null
R3737:Gprc6a UTSW 10 51626911 missense probably benign
R3914:Gprc6a UTSW 10 51628275 missense probably benign 0.00
R3918:Gprc6a UTSW 10 51615680 frame shift probably null
R3964:Gprc6a UTSW 10 51615680 frame shift probably null
R3965:Gprc6a UTSW 10 51615680 frame shift probably null
R3966:Gprc6a UTSW 10 51615680 frame shift probably null
R3973:Gprc6a UTSW 10 51628448 missense possibly damaging 0.93
R3977:Gprc6a UTSW 10 51621101 missense probably benign 0.18
R3978:Gprc6a UTSW 10 51621101 missense probably benign 0.18
R3979:Gprc6a UTSW 10 51621101 missense probably benign 0.18
R4306:Gprc6a UTSW 10 51616639 missense probably damaging 1.00
R4404:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4405:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4408:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4713:Gprc6a UTSW 10 51631457 unclassified probably benign
R4788:Gprc6a UTSW 10 51615008 missense probably benign 0.00
R5248:Gprc6a UTSW 10 51614993 missense probably damaging 1.00
R5263:Gprc6a UTSW 10 51626804 missense probably damaging 1.00
R5436:Gprc6a UTSW 10 51626702 missense probably benign
R5721:Gprc6a UTSW 10 51614980 missense probably benign 0.06
R6061:Gprc6a UTSW 10 51615811 missense probably damaging 1.00
R6092:Gprc6a UTSW 10 51615077 missense probably damaging 1.00
R6132:Gprc6a UTSW 10 51615260 missense possibly damaging 0.89
R6162:Gprc6a UTSW 10 51614912 missense probably benign 0.44
R6207:Gprc6a UTSW 10 51626835 missense probably benign 0.36
R6497:Gprc6a UTSW 10 51615701 missense probably benign 0.05
R6717:Gprc6a UTSW 10 51615137 missense probably damaging 1.00
R6789:Gprc6a UTSW 10 51631316 missense probably damaging 1.00
R6807:Gprc6a UTSW 10 51626745 nonsense probably null
R7000:Gprc6a UTSW 10 51615047 missense probably benign 0.34
R7019:Gprc6a UTSW 10 51631412 missense possibly damaging 0.68
R7143:Gprc6a UTSW 10 51614890 missense probably benign
R7173:Gprc6a UTSW 10 51628499 missense probably benign 0.01
R7579:Gprc6a UTSW 10 51626787 missense probably benign
R7736:Gprc6a UTSW 10 51615453 missense possibly damaging 0.82
R7920:Gprc6a UTSW 10 51614930 missense probably benign 0.02
R8273:Gprc6a UTSW 10 51631274 missense probably benign
R8329:Gprc6a UTSW 10 51627259 nonsense probably null
R8517:Gprc6a UTSW 10 51631241 missense probably benign 0.00
R8815:Gprc6a UTSW 10 51620983 missense probably benign 0.00
Z1177:Gprc6a UTSW 10 51615209 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGAATGACTATAATCTCCACGGCG -3'
(R):5'- TTCAGTTTTGACCCCAAGCTG -3'

Sequencing Primer
(F):5'- ACTTGCCGAATGTGGTAGTATAGAC -3'
(R):5'- GACAATGTTCCTGAAGTGCC -3'
Posted On2021-03-08