Mutagenetix > Incidental Mutation

Incidental Mutation 'R8723:Spag5'

662234

Institutional Source

Beutler Lab

Gene Symbol

Spag5

Ensembl Gene

ENSMUSG00000002055

Gene Name

sperm associated antigen 5

Synonyms

D11Bhm180e, Astrin, MAP126, Deepest, Mastrin, S17, s17

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8723 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

78301529-78322457 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 78321389 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 1081 (I1081N)

Ref Sequence

ENSEMBL: ENSMUSP00000045286 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017534] [ENSMUST00000045026] [ENSMUST00000102478]

AlphaFold

Q7TME2

Predicted Effect

probably benign
Transcript: ENSMUST00000017534

SMART Domains

Protein: ENSMUSP00000017534
Gene: ENSMUSG00000017390

Domain	Start	End	E-Value	Type
Pfam:Glycolytic	15	363	2.6e-185	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000045026
AA Change: I1081N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000045286
Gene: ENSMUSG00000002055
AA Change: I1081N

Domain	Start	End	E-Value	Type
low complexity region	405	420	N/A	INTRINSIC
low complexity region	477	493	N/A	INTRINSIC
coiled coil region	514	547	N/A	INTRINSIC
coiled coil region	638	700	N/A	INTRINSIC
coiled coil region	743	854	N/A	INTRINSIC
low complexity region	898	912	N/A	INTRINSIC
coiled coil region	970	1006	N/A	INTRINSIC
coiled coil region	1032	1068	N/A	INTRINSIC
coiled coil region	1104	1140	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000102478

SMART Domains

Protein: ENSMUSP00000099536
Gene: ENSMUSG00000017390

Domain	Start	End	E-Value	Type
Pfam:Glycolytic	15	363	5.5e-179	PFAM

Meta Mutation Damage Score

0.1094

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein associated with the mitotic spindle apparatus. The encoded protein may be involved in the functional and dynamic regulation of mitotic spindles. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation are viable and fertile with normal breeding and mating behavio; no abnormalities in male reproductive system anatomy or histology or in spermatogenesis were detectable. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017D01Rik	A	G	19: 11,105,691	Y122H	probably damaging	Het
Abca12	A	T	1: 71,321,738	H465Q	probably benign	Het
Adam29	T	C	8: 55,871,478	H647R	probably damaging	Het
Adamtsl4	C	T	3: 95,677,116	R990Q	possibly damaging	Het
Adgrg7	T	G	16: 56,761,919	R285S	probably benign	Het
Alkbh1	A	G	12: 87,438,508	V115A	probably benign	Het
Ankrd50	A	C	3: 38,457,304	F305V	probably damaging	Het
Anpep	A	G	7: 79,838,938	S414P	probably damaging	Het
Anxa3	A	G	5: 96,838,347	I282V	probably benign	Het
Aoah	T	G	13: 21,000,010	Y415D	possibly damaging	Het
Cacna1b	A	G	2: 24,658,498	V1188A	probably damaging	Het
Cnot1	A	G	8: 95,736,279	I1651T	probably benign	Het
Col6a3	C	G	1: 90,767,606		probably benign	Het
Ctnnd1	G	A	2: 84,620,040	P279S	probably benign	Het
Dnah10	A	T	5: 124,814,621	E3298V	probably damaging	Het
Ear14	C	T	14: 51,204,056	T123I	possibly damaging	Het
Elf3	A	G	1: 135,257,647	L43P	possibly damaging	Het
Exoc3l4	T	A	12: 111,430,658		probably benign	Het
Figla	A	G	6: 86,020,742	T151A	probably benign	Het
Fsd1l	A	G	4: 53,647,001	E56G	unknown	Het
Gm49359	A	T	13: 62,454,596	H263Q	probably damaging	Het
Gprc6a	A	T	10: 51,615,422	C744S	probably damaging	Het
Grhl1	G	A	12: 24,612,245		probably benign	Het
Gtf2h5	C	CA	17: 6,084,558		probably null	Het
Itih3	T	A	14: 30,908,804	Q850L	probably damaging	Het
Kcnq5	A	G	1: 21,505,367	V285A	probably damaging	Het
Klc4	T	G	17: 46,640,700	E165A	probably benign	Het
Lrp2	T	C	2: 69,486,304	Y2111C	probably damaging	Het
Lyst	A	G	13: 13,712,757	E3057G	possibly damaging	Het
Macf1	G	A	4: 123,455,117	Q4006*	probably null	Het
Map4k1	G	A	7: 28,987,117	D155N	probably damaging	Het
Myh14	A	G	7: 44,622,983	F1466S	probably damaging	Het
Nrip1	T	C	16: 76,292,665	D668G	probably damaging	Het
Olfr1047	A	T	2: 86,228,442	H176Q	probably damaging	Het
Olfr1141	T	C	2: 87,753,157	T279A	possibly damaging	Het
P2rx1	C	A	11: 73,008,930	N120K	probably benign	Het
Pif1	T	A	9: 65,594,391	M569K	probably damaging	Het
Prkd2	G	A	7: 16,857,777	V578I	possibly damaging	Het
Rhobtb1	A	G	10: 69,270,271	Y284C	probably damaging	Het
Rps6kb1	T	C	11: 86,519,931	T164A	possibly damaging	Het
Rxfp1	T	C	3: 79,650,495	T559A	probably benign	Het
Sag	G	A	1: 87,823,453		probably null	Het
Smoc1	G	A	12: 81,135,812	V138I	possibly damaging	Het
Stk25	A	G	1: 93,625,944	I203T	probably damaging	Het
Strip2	T	A	6: 29,941,864	V611E	probably damaging	Het
Sulf1	A	T	1: 12,786,687	D54V	probably damaging	Het
Tacr2	A	G	10: 62,258,328	D188G	probably damaging	Het
Tmem237	A	T	1: 59,106,572	Y358N	probably damaging	Het
Trim27	A	C	13: 21,190,637		probably benign	Het
Tsen34	A	G	7: 3,695,150	E139G	probably benign	Het
Ttc39a	T	A	4: 109,443,503		probably benign	Het
Tubgcp3	A	T	8: 12,621,899	I781N	probably damaging	Het
Uqcc1	C	T	2: 155,887,180	W21*	probably null	Het
Vmn2r117	A	T	17: 23,477,369	W355R	probably damaging	Het
Vmn2r89	T	C	14: 51,456,453	V420A	probably benign	Het
Zdhhc21	A	T	4: 82,844,202	I52K	probably benign	Het

Other mutations in Spag5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01380:Spag5	APN	11	78304617	missense	possibly damaging	0.62
IGL01820:Spag5	APN	11	78304259	missense	probably benign	0.06
IGL02066:Spag5	APN	11	78304532	missense	probably benign
IGL02140:Spag5	APN	11	78315633	missense	possibly damaging	0.62
IGL02251:Spag5	APN	11	78320034	missense	probably damaging	1.00
IGL02452:Spag5	APN	11	78304623	missense	probably benign	0.08
IGL02658:Spag5	APN	11	78321331	nonsense	probably null
boyardee	UTSW	11	78313191	critical splice donor site	probably null
Franco	UTSW	11	78314182	nonsense	probably null
spaghetto	UTSW	11	78313379	nonsense	probably null
IGL02991:Spag5	UTSW	11	78314251	missense	probably damaging	0.99
R0477:Spag5	UTSW	11	78314198	missense	probably damaging	1.00
R0512:Spag5	UTSW	11	78319586	unclassified	probably benign
R0535:Spag5	UTSW	11	78304728	missense	probably benign	0.00
R0557:Spag5	UTSW	11	78314211	missense	probably damaging	0.99
R0584:Spag5	UTSW	11	78304095	missense	possibly damaging	0.49
R0666:Spag5	UTSW	11	78313396	missense	probably damaging	1.00
R0723:Spag5	UTSW	11	78319584	unclassified	probably benign
R1413:Spag5	UTSW	11	78305317	nonsense	probably null
R1680:Spag5	UTSW	11	78320616	missense	probably damaging	1.00
R1687:Spag5	UTSW	11	78304929	missense	probably benign	0.32
R1696:Spag5	UTSW	11	78321326	missense	probably damaging	1.00
R1831:Spag5	UTSW	11	78314256	missense	probably benign	0.08
R1866:Spag5	UTSW	11	78304455	missense	possibly damaging	0.62
R1918:Spag5	UTSW	11	78304176	missense	probably benign	0.01
R4004:Spag5	UTSW	11	78321529	missense	probably benign	0.22
R4005:Spag5	UTSW	11	78321529	missense	probably benign	0.22
R4222:Spag5	UTSW	11	78304511	missense	probably damaging	1.00
R4750:Spag5	UTSW	11	78320052	missense	probably benign	0.00
R4771:Spag5	UTSW	11	78304766	missense	probably damaging	1.00
R4928:Spag5	UTSW	11	78314373	missense	probably damaging	0.97
R5360:Spag5	UTSW	11	78314762	missense	probably damaging	0.99
R5366:Spag5	UTSW	11	78320326	splice site	probably null
R5618:Spag5	UTSW	11	78304080	missense	probably benign	0.00
R5668:Spag5	UTSW	11	78304716	missense	possibly damaging	0.53
R5762:Spag5	UTSW	11	78304146	missense	probably benign	0.25
R5859:Spag5	UTSW	11	78313534	missense	probably benign	0.38
R6564:Spag5	UTSW	11	78315575	missense	probably damaging	1.00
R6571:Spag5	UTSW	11	78321269	missense	probably damaging	1.00
R6573:Spag5	UTSW	11	78314182	nonsense	probably null
R7074:Spag5	UTSW	11	78305042	critical splice donor site	probably null
R7091:Spag5	UTSW	11	78313191	critical splice donor site	probably null
R7332:Spag5	UTSW	11	78313379	nonsense	probably null
R8073:Spag5	UTSW	11	78301977	missense	probably benign	0.22
R8709:Spag5	UTSW	11	78301912	missense	probably benign
R8976:Spag5	UTSW	11	78304587	missense	probably benign	0.01
R9053:Spag5	UTSW	11	78321749	missense	probably benign	0.14
R9142:Spag5	UTSW	11	78301997	missense	possibly damaging	0.56
Z1176:Spag5	UTSW	11	78314982	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- GAACCTCTGAGTACTGTTGGG -3'
(R):5'- GCTTCTGTGGTGGAAGGAAAC -3'

Sequencing Primer
(F):5'- AACCTCTGAGTACTGTTGGGTTATC -3'
(R):5'- AGAACTGCTTACATGGCTCAG -3'

Posted On

2021-03-08