Incidental Mutation 'R8724:Rev1'
ID 662251
Institutional Source Beutler Lab
Gene Symbol Rev1
Ensembl Gene ENSMUSG00000026082
Gene Name REV1, DNA directed polymerase
Synonyms 1110027I23Rik, Rev1l, REV1
MMRRC Submission 068573-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.921) question?
Stock # R8724 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 38091867-38168882 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 38127150 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 370 (V370G)
Ref Sequence ENSEMBL: ENSMUSP00000027251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027251] [ENSMUST00000192594]
AlphaFold Q920Q2
PDB Structure Solution structure of the mouse Rev1 C-terminal domain [SOLUTION NMR]
Solution structure of the mouse Rev1 CTD in complex with the Rev1-interacting Region (RIR)of Pol Kappa [SOLUTION NMR]
Structure of the Rev1 CTD-Rev3/7-Pol kappa RIR complex [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000027251
AA Change: V370G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027251
Gene: ENSMUSG00000026082
AA Change: V370G

DomainStartEndE-ValueType
BRCT 46 121 3.99e-13 SMART
low complexity region 320 342 N/A INTRINSIC
Pfam:IMS 420 620 1.9e-43 PFAM
Pfam:IMS_C 700 831 5.8e-20 PFAM
low complexity region 888 901 N/A INTRINSIC
Pfam:DUF4414 938 1071 9.7e-11 PFAM
Pfam:REV1_C 1127 1248 1.2e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192594
SMART Domains Protein: ENSMUSP00000141379
Gene: ENSMUSG00000026082

DomainStartEndE-ValueType
BRCT 46 121 2.5e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193472
Predicted Effect probably benign
Transcript: ENSMUST00000194815
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with similarity to the S. cerevisiae mutagenesis protein Rev1. The Rev1 proteins contain a BRCT domain, which is important in protein-protein interactions. A suggested role for the human Rev1-like protein is as a scaffold that recruits DNA polymerases involved in translesion synthesis (TLS) of damaged DNA. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit abnormal somatic hypermutation frequency of the Ig gene. Mice homozygous for a knock-out allele exhibit background-sensitive prenatal lethality and abnormal somatic hypermutation frequency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl4 C T 3: 95,584,426 (GRCm39) R990Q possibly damaging Het
Ampd2 C A 3: 107,987,432 (GRCm39) V134L probably benign Het
Ank2 A T 3: 126,737,405 (GRCm39) D2826E unknown Het
Asb3 A T 11: 31,051,120 (GRCm39) I486F probably damaging Het
Atg4b A T 1: 93,696,023 (GRCm39) Y54F probably damaging Het
Atp1a2 T A 1: 172,106,945 (GRCm39) I792F probably benign Het
Bltp1 G A 3: 36,945,042 (GRCm39) V334I probably damaging Het
Ccser1 A C 6: 61,288,199 (GRCm39) S121R probably damaging Het
Cdc40 C T 10: 40,717,480 (GRCm39) D404N probably damaging Het
Cep120 A T 18: 53,856,199 (GRCm39) V406E possibly damaging Het
Ces2g C A 8: 105,692,955 (GRCm39) A331D probably benign Het
Csnk1g2 G A 10: 80,474,760 (GRCm39) R299H probably damaging Het
Dlat G T 9: 50,560,967 (GRCm39) A360E probably damaging Het
Dock10 T G 1: 80,570,344 (GRCm39) I371L probably benign Het
Dpp9 T A 17: 56,512,867 (GRCm39) T114S probably benign Het
Dusp13b T C 14: 21,796,475 (GRCm39) R160G probably benign Het
Dync2i2 T C 2: 29,923,961 (GRCm39) D188G probably benign Het
Edem3 A G 1: 151,651,624 (GRCm39) K122R possibly damaging Het
Ehbp1l1 A G 19: 5,765,886 (GRCm39) S1486P possibly damaging Het
Elf3 A G 1: 135,182,098 (GRCm39) I361T probably damaging Het
Epha3 C T 16: 63,403,818 (GRCm39) C761Y probably damaging Het
Ephb2 A G 4: 136,498,368 (GRCm39) I237T probably damaging Het
Eya1 A T 1: 14,279,206 (GRCm39) D346E probably benign Het
Fat2 T C 11: 55,173,786 (GRCm39) Y2309C probably damaging Het
Fbn1 T C 2: 125,202,066 (GRCm39) D1269G probably damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,436,769 (GRCm39) probably benign Het
Fnbp4 T C 2: 90,577,097 (GRCm39) V143A probably damaging Het
Foxo6 A G 4: 120,144,109 (GRCm39) I114T probably damaging Het
Gm6741 T C 17: 91,544,564 (GRCm39) I109T probably benign Het
Gtf2h5 C CA 17: 6,134,833 (GRCm39) probably null Het
Hsf1 C T 15: 76,381,999 (GRCm39) S199L probably damaging Het
Htr3a T C 9: 48,815,981 (GRCm39) N152S probably damaging Het
Ikzf2 T A 1: 69,617,100 (GRCm39) E82D probably benign Het
Kank2 T G 9: 21,705,917 (GRCm39) K367T possibly damaging Het
Kif20b T A 19: 34,916,146 (GRCm39) probably benign Het
Ktn1 G A 14: 47,931,335 (GRCm39) V643I probably benign Het
Lipk G A 19: 33,996,120 (GRCm39) V11M probably benign Het
Med4 T A 14: 73,751,249 (GRCm39) L66* probably null Het
Mtus1 T C 8: 41,451,500 (GRCm39) K379E probably damaging Het
Nat1 T A 8: 67,944,443 (GRCm39) I276N probably damaging Het
Nav2 G A 7: 49,141,184 (GRCm39) V910M possibly damaging Het
Or10ag53 T A 2: 87,082,704 (GRCm39) I141N probably damaging Het
Or4a80 A T 2: 89,582,373 (GRCm39) D266E probably damaging Het
Pcdh9 A G 14: 94,124,583 (GRCm39) V529A probably benign Het
Pcdhga7 C T 18: 37,848,146 (GRCm39) T51I probably benign Het
Pdcd1 A G 1: 93,968,956 (GRCm39) Y121H probably damaging Het
Pdia6 A G 12: 17,333,982 (GRCm39) D438G unknown Het
Pgm1 A G 4: 99,786,964 (GRCm39) T68A probably benign Het
Pik3c2g G A 6: 139,913,619 (GRCm39) V1006I unknown Het
Plk4 C T 3: 40,768,022 (GRCm39) T855I probably damaging Het
Pnldc1 T A 17: 13,111,703 (GRCm39) N335Y probably damaging Het
Prkcq C T 2: 11,304,784 (GRCm39) P658S probably benign Het
Rbl2 T C 8: 91,841,837 (GRCm39) I1011T possibly damaging Het
Rtn4 A G 11: 29,643,316 (GRCm39) E43G unknown Het
Rtp2 C T 16: 23,746,064 (GRCm39) G189D possibly damaging Het
Ryr1 G A 7: 28,816,802 (GRCm39) A78V probably benign Het
Sel1l3 A C 5: 53,293,165 (GRCm39) Y850* probably null Het
Senp3 T C 11: 69,564,419 (GRCm39) Q547R probably damaging Het
Siglecf T C 7: 43,004,976 (GRCm39) L402P probably damaging Het
Slc24a1 T C 9: 64,855,453 (GRCm39) I485V probably benign Het
Slc45a2 T A 15: 11,012,610 (GRCm39) H204Q probably benign Het
Slc9a4 T G 1: 40,623,301 (GRCm39) I180S probably damaging Het
Smyd1 T A 6: 71,193,767 (GRCm39) Y420F probably damaging Het
Sorcs1 A G 19: 50,139,658 (GRCm39) I1168T probably benign Het
Syne1 T C 10: 5,033,861 (GRCm39) E7737G possibly damaging Het
Trappc4 T A 9: 44,316,560 (GRCm39) H145L probably benign Het
Wdr75 T A 1: 45,856,560 (GRCm39) W528R probably damaging Het
Zc3h13 T C 14: 75,569,512 (GRCm39) V1453A probably benign Het
Zfp143 T C 7: 109,681,110 (GRCm39) I318T probably benign Het
Zfp846 G A 9: 20,505,352 (GRCm39) R404H possibly damaging Het
Other mutations in Rev1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Rev1 APN 1 38,138,021 (GRCm39) missense probably damaging 1.00
IGL01065:Rev1 APN 1 38,138,090 (GRCm39) missense possibly damaging 0.89
IGL01393:Rev1 APN 1 38,131,144 (GRCm39) missense probably damaging 1.00
IGL03003:Rev1 APN 1 38,127,154 (GRCm39) missense possibly damaging 0.77
H8562:Rev1 UTSW 1 38,095,848 (GRCm39) missense probably damaging 0.96
PIT1430001:Rev1 UTSW 1 38,095,337 (GRCm39) unclassified probably benign
R0409:Rev1 UTSW 1 38,113,449 (GRCm39) nonsense probably null
R0606:Rev1 UTSW 1 38,098,204 (GRCm39) missense probably null 1.00
R1134:Rev1 UTSW 1 38,096,768 (GRCm39) missense probably benign 0.04
R1171:Rev1 UTSW 1 38,127,581 (GRCm39) missense possibly damaging 0.89
R1208:Rev1 UTSW 1 38,098,199 (GRCm39) unclassified probably benign
R1440:Rev1 UTSW 1 38,127,286 (GRCm39) missense probably damaging 1.00
R1485:Rev1 UTSW 1 38,127,653 (GRCm39) missense probably benign 0.00
R1627:Rev1 UTSW 1 38,094,571 (GRCm39) missense probably damaging 0.99
R3845:Rev1 UTSW 1 38,138,069 (GRCm39) missense probably damaging 0.99
R3948:Rev1 UTSW 1 38,113,414 (GRCm39) missense possibly damaging 0.69
R4074:Rev1 UTSW 1 38,093,319 (GRCm39) missense possibly damaging 0.50
R4075:Rev1 UTSW 1 38,093,319 (GRCm39) missense possibly damaging 0.50
R4076:Rev1 UTSW 1 38,093,319 (GRCm39) missense possibly damaging 0.50
R4248:Rev1 UTSW 1 38,146,729 (GRCm39) missense possibly damaging 0.87
R4293:Rev1 UTSW 1 38,147,500 (GRCm39) missense possibly damaging 0.89
R4548:Rev1 UTSW 1 38,098,275 (GRCm39) missense possibly damaging 0.72
R4610:Rev1 UTSW 1 38,092,730 (GRCm39) missense probably damaging 1.00
R4654:Rev1 UTSW 1 38,118,337 (GRCm39) intron probably benign
R5032:Rev1 UTSW 1 38,113,570 (GRCm39) intron probably benign
R5286:Rev1 UTSW 1 38,094,407 (GRCm39) nonsense probably null
R5311:Rev1 UTSW 1 38,118,474 (GRCm39) missense probably benign 0.00
R5327:Rev1 UTSW 1 38,147,532 (GRCm39) nonsense probably null
R6363:Rev1 UTSW 1 38,110,570 (GRCm39) missense probably damaging 1.00
R7050:Rev1 UTSW 1 38,093,352 (GRCm39) missense probably damaging 1.00
R7072:Rev1 UTSW 1 38,106,626 (GRCm39) nonsense probably null
R7132:Rev1 UTSW 1 38,110,530 (GRCm39) missense possibly damaging 0.95
R7264:Rev1 UTSW 1 38,124,682 (GRCm39) missense probably damaging 1.00
R7298:Rev1 UTSW 1 38,092,185 (GRCm39) missense probably damaging 1.00
R7367:Rev1 UTSW 1 38,113,488 (GRCm39) nonsense probably null
R7395:Rev1 UTSW 1 38,127,146 (GRCm39) missense possibly damaging 0.69
R7829:Rev1 UTSW 1 38,095,526 (GRCm39) missense probably damaging 0.98
R8053:Rev1 UTSW 1 38,102,222 (GRCm39) missense possibly damaging 0.67
R8093:Rev1 UTSW 1 38,114,097 (GRCm39) intron probably benign
R8356:Rev1 UTSW 1 38,098,324 (GRCm39) nonsense probably null
R8456:Rev1 UTSW 1 38,098,324 (GRCm39) nonsense probably null
R8461:Rev1 UTSW 1 38,122,868 (GRCm39) missense possibly damaging 0.56
R8757:Rev1 UTSW 1 38,098,353 (GRCm39) missense probably damaging 1.00
R8759:Rev1 UTSW 1 38,098,353 (GRCm39) missense probably damaging 1.00
R8945:Rev1 UTSW 1 38,122,824 (GRCm39) missense probably damaging 0.98
R9309:Rev1 UTSW 1 38,093,945 (GRCm39) missense probably damaging 1.00
R9433:Rev1 UTSW 1 38,092,173 (GRCm39) missense probably damaging 1.00
R9500:Rev1 UTSW 1 38,102,214 (GRCm39) nonsense probably null
X0017:Rev1 UTSW 1 38,092,742 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCTGGTATTCCTGAAGGTTTTC -3'
(R):5'- AAGTGCAGATGCTTTGCGG -3'

Sequencing Primer
(F):5'- CTACCTGTGTCAGTTACAACA -3'
(R):5'- AGATGCTTTGCGGAGTCCAC -3'
Posted On 2021-03-08