Incidental Mutation 'R8724:Pgm2'
ID662273
Institutional Source Beutler Lab
Gene Symbol Pgm2
Ensembl Gene ENSMUSG00000025791
Gene Namephosphoglucomutase 2
Synonyms2610020G18Rik, Pgm-2
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.724) question?
Stock #R8724 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location99929414-99987294 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99929767 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 68 (T68A)
Ref Sequence ENSEMBL: ENSMUSP00000061227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058351]
Predicted Effect probably benign
Transcript: ENSMUST00000058351
AA Change: T68A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000061227
Gene: ENSMUSG00000025791
AA Change: T68A

DomainStartEndE-ValueType
Pfam:PGM_PMM_I 14 158 1.7e-42 PFAM
Pfam:PGM_PMM_II 193 301 3.3e-20 PFAM
Pfam:PGM_PMM_III 306 420 1.1e-33 PFAM
Pfam:PGM_PMM_IV 436 543 1.1e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an isozyme of phosphoglucomutase (PGM) and belongs to the phosphohexose mutase family. There are several PGM isozymes, which are encoded by different genes and catalyze the transfer of phosphate between the 1 and 6 positions of glucose. In most cell types, this PGM isozyme is predominant, representing about 90% of total PGM activity. In red cells, PGM2 is a major isozyme. This gene is highly polymorphic. Mutations in this gene cause glycogen storage disease type 14. Alternativley spliced transcript variants encoding different isoforms have been identified in this gene.[provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik G A 3: 36,890,893 V334I probably damaging Het
Adamtsl4 C T 3: 95,677,116 R990Q possibly damaging Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Ank2 A T 3: 126,943,756 D2826E unknown Het
Asb3 A T 11: 31,101,120 I486F probably damaging Het
Atg4b A T 1: 93,768,301 Y54F probably damaging Het
Atp1a2 T A 1: 172,279,378 I792F probably benign Het
Ccser1 A C 6: 61,311,215 S121R probably damaging Het
Cdc40 C T 10: 40,841,484 D404N probably damaging Het
Cep120 A T 18: 53,723,127 V406E possibly damaging Het
Ces2g C A 8: 104,966,323 A331D probably benign Het
Csnk1g2 G A 10: 80,638,926 R299H probably damaging Het
Dlat G T 9: 50,649,667 A360E probably damaging Het
Dock10 T G 1: 80,592,627 I371L probably benign Het
Dpp9 T A 17: 56,205,867 T114S probably benign Het
Dusp13 T C 14: 21,746,407 R160G probably benign Het
Edem3 A G 1: 151,775,873 K122R possibly damaging Het
Ehbp1l1 A G 19: 5,715,858 S1486P possibly damaging Het
Elf3 A G 1: 135,254,360 I361T probably damaging Het
Epha3 C T 16: 63,583,455 C761Y probably damaging Het
Ephb2 A G 4: 136,771,057 I237T probably damaging Het
Eya1 A T 1: 14,208,982 D346E probably benign Het
Fat2 T C 11: 55,282,960 Y2309C probably damaging Het
Fbn1 T C 2: 125,360,146 D1269G probably damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,609,203 probably benign Het
Fnbp4 T C 2: 90,746,753 V143A probably damaging Het
Foxo6 A G 4: 120,286,912 I114T probably damaging Het
Gm6741 T C 17: 91,237,136 I109T probably benign Het
Gtf2h5 C CA 17: 6,084,558 probably null Het
Hsf1 C T 15: 76,497,799 S199L probably damaging Het
Htr3a T C 9: 48,904,681 N152S probably damaging Het
Ikzf2 T A 1: 69,577,941 E82D probably benign Het
Kank2 T G 9: 21,794,621 K367T possibly damaging Het
Ktn1 G A 14: 47,693,878 V643I probably benign Het
Lipk G A 19: 34,018,720 V11M probably benign Het
Med4 T A 14: 73,513,809 L66* probably null Het
Mtus1 T C 8: 40,998,463 K379E probably damaging Het
Nat1 T A 8: 67,491,791 I276N probably damaging Het
Nav2 G A 7: 49,491,436 V910M possibly damaging Het
Olfr1115 T A 2: 87,252,360 I141N probably damaging Het
Olfr1253 A T 2: 89,752,029 D266E probably damaging Het
Pcdh9 A G 14: 93,887,147 V529A probably benign Het
Pcdhga7 C T 18: 37,715,093 T51I probably benign Het
Pdcd1 A G 1: 94,041,231 Y121H probably damaging Het
Pdia6 A G 12: 17,283,981 D438G unknown Het
Pik3c2g G A 6: 139,967,893 V1006I unknown Het
Plk4 C T 3: 40,813,587 T855I probably damaging Het
Pnldc1 T A 17: 12,892,816 N335Y probably damaging Het
Prkcq C T 2: 11,299,973 P658S probably benign Het
Rbl2 T C 8: 91,115,209 I1011T possibly damaging Het
Rev1 A C 1: 38,088,069 V370G probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,920 probably benign Het
Rtn4 A G 11: 29,693,316 E43G unknown Het
Rtp2 C T 16: 23,927,314 G189D possibly damaging Het
Ryr1 G A 7: 29,117,377 A78V probably benign Het
Sel1l3 A C 5: 53,135,823 Y850* probably null Het
Senp3 T C 11: 69,673,593 Q547R probably damaging Het
Siglecf T C 7: 43,355,552 L402P probably damaging Het
Slc24a1 T C 9: 64,948,171 I485V probably benign Het
Slc45a2 T A 15: 11,012,524 H204Q probably benign Het
Slc9a4 T G 1: 40,584,141 I180S probably damaging Het
Smyd1 T A 6: 71,216,783 Y420F probably damaging Het
Sorcs1 A G 19: 50,151,220 I1168T probably benign Het
Syne1 T C 10: 5,083,861 E7737G possibly damaging Het
Trappc4 T A 9: 44,405,263 H145L probably benign Het
Wdr34 T C 2: 30,033,949 D188G probably benign Het
Wdr75 T A 1: 45,817,400 W528R probably damaging Het
Zc3h13 T C 14: 75,332,072 V1453A probably benign Het
Zfp143 T C 7: 110,081,903 I318T probably benign Het
Zfp846 G A 9: 20,594,056 R404H possibly damaging Het
Other mutations in Pgm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Pgm2 APN 4 99929606 missense probably damaging 1.00
IGL01468:Pgm2 APN 4 99962170 missense possibly damaging 0.82
IGL02013:Pgm2 APN 4 99983961 splice site probably benign
IGL02237:Pgm2 APN 4 99963510 splice site probably benign
IGL02945:Pgm2 APN 4 99961534 missense probably benign
IGL03201:Pgm2 APN 4 99970039 missense probably damaging 0.99
IGL03373:Pgm2 APN 4 99961544 missense probably damaging 1.00
R0349:Pgm2 UTSW 4 99963617 missense probably damaging 1.00
R0683:Pgm2 UTSW 4 99961543 missense probably damaging 0.99
R1650:Pgm2 UTSW 4 99962070 missense possibly damaging 0.70
R1650:Pgm2 UTSW 4 99962079 missense probably benign 0.28
R1741:Pgm2 UTSW 4 99964865 splice site probably null
R1759:Pgm2 UTSW 4 99967108 missense probably damaging 1.00
R1843:Pgm2 UTSW 4 99961478 missense probably damaging 1.00
R3111:Pgm2 UTSW 4 99956025 missense probably benign
R4115:Pgm2 UTSW 4 99962151 nonsense probably null
R4426:Pgm2 UTSW 4 99962140 missense probably benign 0.04
R4748:Pgm2 UTSW 4 99981979 missense probably benign 0.24
R4910:Pgm2 UTSW 4 99963527 missense probably damaging 1.00
R4920:Pgm2 UTSW 4 99986733 missense probably damaging 1.00
R5289:Pgm2 UTSW 4 99967069 missense probably damaging 1.00
R5764:Pgm2 UTSW 4 99964846 missense probably damaging 1.00
R6199:Pgm2 UTSW 4 99978954 missense probably damaging 1.00
R6311:Pgm2 UTSW 4 99970040 missense possibly damaging 0.93
R6600:Pgm2 UTSW 4 99967062 nonsense probably null
R6818:Pgm2 UTSW 4 99963566 missense probably damaging 1.00
R6892:Pgm2 UTSW 4 99929708 missense probably benign
R6984:Pgm2 UTSW 4 99929654 missense probably benign 0.04
R7429:Pgm2 UTSW 4 99955995 start codon destroyed probably null
R7430:Pgm2 UTSW 4 99955995 start codon destroyed probably null
R8017:Pgm2 UTSW 4 99986678 missense probably benign 0.00
R8019:Pgm2 UTSW 4 99986678 missense probably benign 0.00
R8143:Pgm2 UTSW 4 99967218 splice site probably null
R8893:Pgm2 UTSW 4 99967100 missense not run
RF018:Pgm2 UTSW 4 99962303 splice site probably null
Z1176:Pgm2 UTSW 4 99978997 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATATCCGGATCAGAAGCC -3'
(R):5'- ATAGCCATTGCGAAACGTGGG -3'

Sequencing Primer
(F):5'- GATCAGAAGCCGGGCAC -3'
(R):5'- CATTGCGAAACGTGGGGTGTG -3'
Posted On2021-03-08