Incidental Mutation 'R8724:Ccser1'
ID 662277
Institutional Source Beutler Lab
Gene Symbol Ccser1
Ensembl Gene ENSMUSG00000039578
Gene Name coiled-coil serine rich 1
Synonyms 6230405M12Rik, C130092O11Rik, Fam190a
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock # R8724 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 61180324-62382865 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 61311215 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 121 (S121R)
Ref Sequence ENSEMBL: ENSMUSP00000040251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045522] [ENSMUST00000126214]
AlphaFold Q8C0C4
Predicted Effect probably damaging
Transcript: ENSMUST00000045522
AA Change: S121R

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000040251
Gene: ENSMUSG00000039578
AA Change: S121R

DomainStartEndE-ValueType
low complexity region 28 36 N/A INTRINSIC
low complexity region 43 61 N/A INTRINSIC
low complexity region 435 446 N/A INTRINSIC
low complexity region 510 525 N/A INTRINSIC
low complexity region 645 659 N/A INTRINSIC
coiled coil region 674 703 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000126214
AA Change: S121R

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122894
Gene: ENSMUSG00000039578
AA Change: S121R

DomainStartEndE-ValueType
low complexity region 28 36 N/A INTRINSIC
low complexity region 43 61 N/A INTRINSIC
low complexity region 435 446 N/A INTRINSIC
low complexity region 510 525 N/A INTRINSIC
low complexity region 645 659 N/A INTRINSIC
coiled coil region 674 703 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 99% (69/70)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik G A 3: 36,890,893 V334I probably damaging Het
Adamtsl4 C T 3: 95,677,116 R990Q possibly damaging Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Ank2 A T 3: 126,943,756 D2826E unknown Het
Asb3 A T 11: 31,101,120 I486F probably damaging Het
Atg4b A T 1: 93,768,301 Y54F probably damaging Het
Atp1a2 T A 1: 172,279,378 I792F probably benign Het
Cdc40 C T 10: 40,841,484 D404N probably damaging Het
Cep120 A T 18: 53,723,127 V406E possibly damaging Het
Ces2g C A 8: 104,966,323 A331D probably benign Het
Csnk1g2 G A 10: 80,638,926 R299H probably damaging Het
Dlat G T 9: 50,649,667 A360E probably damaging Het
Dock10 T G 1: 80,592,627 I371L probably benign Het
Dpp9 T A 17: 56,205,867 T114S probably benign Het
Dusp13 T C 14: 21,746,407 R160G probably benign Het
Edem3 A G 1: 151,775,873 K122R possibly damaging Het
Ehbp1l1 A G 19: 5,715,858 S1486P possibly damaging Het
Elf3 A G 1: 135,254,360 I361T probably damaging Het
Epha3 C T 16: 63,583,455 C761Y probably damaging Het
Ephb2 A G 4: 136,771,057 I237T probably damaging Het
Eya1 A T 1: 14,208,982 D346E probably benign Het
Fat2 T C 11: 55,282,960 Y2309C probably damaging Het
Fbn1 T C 2: 125,360,146 D1269G probably damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,609,203 probably benign Het
Fnbp4 T C 2: 90,746,753 V143A probably damaging Het
Foxo6 A G 4: 120,286,912 I114T probably damaging Het
Gm6741 T C 17: 91,237,136 I109T probably benign Het
Gtf2h5 C CA 17: 6,084,558 probably null Het
Hsf1 C T 15: 76,497,799 S199L probably damaging Het
Htr3a T C 9: 48,904,681 N152S probably damaging Het
Ikzf2 T A 1: 69,577,941 E82D probably benign Het
Kank2 T G 9: 21,794,621 K367T possibly damaging Het
Kif20b T A 19: 34,938,746 probably benign Het
Ktn1 G A 14: 47,693,878 V643I probably benign Het
Lipk G A 19: 34,018,720 V11M probably benign Het
Med4 T A 14: 73,513,809 L66* probably null Het
Mtus1 T C 8: 40,998,463 K379E probably damaging Het
Nat1 T A 8: 67,491,791 I276N probably damaging Het
Nav2 G A 7: 49,491,436 V910M possibly damaging Het
Olfr1115 T A 2: 87,252,360 I141N probably damaging Het
Olfr1253 A T 2: 89,752,029 D266E probably damaging Het
Pcdh9 A G 14: 93,887,147 V529A probably benign Het
Pcdhga7 C T 18: 37,715,093 T51I probably benign Het
Pdcd1 A G 1: 94,041,231 Y121H probably damaging Het
Pdia6 A G 12: 17,283,981 D438G unknown Het
Pgm2 A G 4: 99,929,767 T68A probably benign Het
Pik3c2g G A 6: 139,967,893 V1006I unknown Het
Plk4 C T 3: 40,813,587 T855I probably damaging Het
Pnldc1 T A 17: 12,892,816 N335Y probably damaging Het
Prkcq C T 2: 11,299,973 P658S probably benign Het
Rbl2 T C 8: 91,115,209 I1011T possibly damaging Het
Rev1 A C 1: 38,088,069 V370G probably damaging Het
Rtn4 A G 11: 29,693,316 E43G unknown Het
Rtp2 C T 16: 23,927,314 G189D possibly damaging Het
Ryr1 G A 7: 29,117,377 A78V probably benign Het
Sel1l3 A C 5: 53,135,823 Y850* probably null Het
Senp3 T C 11: 69,673,593 Q547R probably damaging Het
Siglecf T C 7: 43,355,552 L402P probably damaging Het
Slc24a1 T C 9: 64,948,171 I485V probably benign Het
Slc45a2 T A 15: 11,012,524 H204Q probably benign Het
Slc9a4 T G 1: 40,584,141 I180S probably damaging Het
Smyd1 T A 6: 71,216,783 Y420F probably damaging Het
Sorcs1 A G 19: 50,151,220 I1168T probably benign Het
Syne1 T C 10: 5,083,861 E7737G possibly damaging Het
Trappc4 T A 9: 44,405,263 H145L probably benign Het
Wdr34 T C 2: 30,033,949 D188G probably benign Het
Wdr75 T A 1: 45,817,400 W528R probably damaging Het
Zc3h13 T C 14: 75,332,072 V1453A probably benign Het
Zfp143 T C 7: 110,081,903 I318T probably benign Het
Zfp846 G A 9: 20,594,056 R404H possibly damaging Het
Other mutations in Ccser1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Ccser1 APN 6 62380142 missense possibly damaging 0.80
IGL00858:Ccser1 APN 6 61810665 nonsense probably null
IGL01012:Ccser1 APN 6 61638490 missense probably benign 0.01
IGL01391:Ccser1 APN 6 61638521 splice site probably benign
IGL01643:Ccser1 APN 6 61311855 missense probably benign 0.01
IGL01767:Ccser1 APN 6 61718152 missense probably benign 0.03
IGL02081:Ccser1 APN 6 61311168 nonsense probably null
IGL02152:Ccser1 APN 6 61311708 missense possibly damaging 0.57
IGL02870:Ccser1 APN 6 61311292 missense probably damaging 0.99
IGL02890:Ccser1 APN 6 62379831 missense probably damaging 0.99
IGL03147:Ccser1 UTSW 6 61312160 missense probably benign 0.02
R0020:Ccser1 UTSW 6 61313804 missense possibly damaging 0.62
R0831:Ccser1 UTSW 6 61423061 missense probably damaging 0.99
R1306:Ccser1 UTSW 6 62380106 missense probably damaging 0.99
R1441:Ccser1 UTSW 6 62380032 missense probably benign 0.00
R1650:Ccser1 UTSW 6 61638490 missense probably benign 0.01
R1653:Ccser1 UTSW 6 61311465 missense probably benign 0.00
R1913:Ccser1 UTSW 6 62379894 missense probably damaging 0.99
R1961:Ccser1 UTSW 6 61313646 splice site probably benign
R2030:Ccser1 UTSW 6 61311563 missense probably benign
R2056:Ccser1 UTSW 6 61422952 splice site probably null
R2268:Ccser1 UTSW 6 61570843 missense probably damaging 1.00
R2280:Ccser1 UTSW 6 61570815 missense probably damaging 1.00
R2281:Ccser1 UTSW 6 61570815 missense probably damaging 1.00
R2571:Ccser1 UTSW 6 61422960 missense probably damaging 1.00
R4606:Ccser1 UTSW 6 61311584 missense probably damaging 0.99
R4711:Ccser1 UTSW 6 61311926 missense possibly damaging 0.74
R4770:Ccser1 UTSW 6 61311501 missense possibly damaging 0.85
R4932:Ccser1 UTSW 6 61718191 missense possibly damaging 0.78
R5078:Ccser1 UTSW 6 61311366 missense probably damaging 0.97
R5097:Ccser1 UTSW 6 61312160 missense probably benign 0.02
R5221:Ccser1 UTSW 6 61312091 missense probably damaging 0.99
R5378:Ccser1 UTSW 6 61311666 missense probably benign 0.00
R5604:Ccser1 UTSW 6 61313804 missense probably damaging 0.97
R5700:Ccser1 UTSW 6 61311276 missense probably benign 0.00
R5970:Ccser1 UTSW 6 61311242 missense possibly damaging 0.94
R6257:Ccser1 UTSW 6 61373962 missense probably damaging 0.96
R6257:Ccser1 UTSW 6 62379785 missense probably benign
R6375:Ccser1 UTSW 6 61311168 nonsense probably null
R6703:Ccser1 UTSW 6 61638511 nonsense probably null
R6930:Ccser1 UTSW 6 62380025 missense probably benign 0.03
R7256:Ccser1 UTSW 6 61311867 missense probably benign 0.38
R7362:Ccser1 UTSW 6 61810880 missense unknown
R7508:Ccser1 UTSW 6 61570723 missense probably benign 0.05
R7532:Ccser1 UTSW 6 62379931 nonsense probably null
R7533:Ccser1 UTSW 6 61638490 missense probably benign 0.25
R7729:Ccser1 UTSW 6 61311856 missense probably benign
R7875:Ccser1 UTSW 6 61311948 missense probably benign 0.06
R8055:Ccser1 UTSW 6 61313773 missense possibly damaging 0.47
R8396:Ccser1 UTSW 6 61312104 missense probably benign 0.09
R8849:Ccser1 UTSW 6 61311553 missense probably benign 0.00
R8906:Ccser1 UTSW 6 61810858 missense probably benign 0.00
R9058:Ccser1 UTSW 6 61373992 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGCACTAACTCGAGCTC -3'
(R):5'- AGCAGCTTCTTGGTGGACTG -3'

Sequencing Primer
(F):5'- CACTAACTCGAGCTCAGGGAG -3'
(R):5'- GACTGTTTAATAGAACGGCGACTTTG -3'
Posted On 2021-03-08