Incidental Mutation 'R8724:Ccser1'
ID 662277
Institutional Source Beutler Lab
Gene Symbol Ccser1
Ensembl Gene ENSMUSG00000039578
Gene Name coiled-coil serine rich 1
Synonyms 6230405M12Rik, Fam190a, C130092O11Rik
MMRRC Submission 068573-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.169) question?
Stock # R8724 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 61157308-62359849 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 61288199 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 121 (S121R)
Ref Sequence ENSEMBL: ENSMUSP00000040251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045522] [ENSMUST00000126214]
AlphaFold Q8C0C4
Predicted Effect probably damaging
Transcript: ENSMUST00000045522
AA Change: S121R

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000040251
Gene: ENSMUSG00000039578
AA Change: S121R

DomainStartEndE-ValueType
low complexity region 28 36 N/A INTRINSIC
low complexity region 43 61 N/A INTRINSIC
low complexity region 435 446 N/A INTRINSIC
low complexity region 510 525 N/A INTRINSIC
low complexity region 645 659 N/A INTRINSIC
coiled coil region 674 703 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000126214
AA Change: S121R

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122894
Gene: ENSMUSG00000039578
AA Change: S121R

DomainStartEndE-ValueType
low complexity region 28 36 N/A INTRINSIC
low complexity region 43 61 N/A INTRINSIC
low complexity region 435 446 N/A INTRINSIC
low complexity region 510 525 N/A INTRINSIC
low complexity region 645 659 N/A INTRINSIC
coiled coil region 674 703 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 99% (69/70)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl4 C T 3: 95,584,426 (GRCm39) R990Q possibly damaging Het
Ampd2 C A 3: 107,987,432 (GRCm39) V134L probably benign Het
Ank2 A T 3: 126,737,405 (GRCm39) D2826E unknown Het
Asb3 A T 11: 31,051,120 (GRCm39) I486F probably damaging Het
Atg4b A T 1: 93,696,023 (GRCm39) Y54F probably damaging Het
Atp1a2 T A 1: 172,106,945 (GRCm39) I792F probably benign Het
Bltp1 G A 3: 36,945,042 (GRCm39) V334I probably damaging Het
Cdc40 C T 10: 40,717,480 (GRCm39) D404N probably damaging Het
Cep120 A T 18: 53,856,199 (GRCm39) V406E possibly damaging Het
Ces2g C A 8: 105,692,955 (GRCm39) A331D probably benign Het
Csnk1g2 G A 10: 80,474,760 (GRCm39) R299H probably damaging Het
Dlat G T 9: 50,560,967 (GRCm39) A360E probably damaging Het
Dock10 T G 1: 80,570,344 (GRCm39) I371L probably benign Het
Dpp9 T A 17: 56,512,867 (GRCm39) T114S probably benign Het
Dusp13b T C 14: 21,796,475 (GRCm39) R160G probably benign Het
Dync2i2 T C 2: 29,923,961 (GRCm39) D188G probably benign Het
Edem3 A G 1: 151,651,624 (GRCm39) K122R possibly damaging Het
Ehbp1l1 A G 19: 5,765,886 (GRCm39) S1486P possibly damaging Het
Elf3 A G 1: 135,182,098 (GRCm39) I361T probably damaging Het
Epha3 C T 16: 63,403,818 (GRCm39) C761Y probably damaging Het
Ephb2 A G 4: 136,498,368 (GRCm39) I237T probably damaging Het
Eya1 A T 1: 14,279,206 (GRCm39) D346E probably benign Het
Fat2 T C 11: 55,173,786 (GRCm39) Y2309C probably damaging Het
Fbn1 T C 2: 125,202,066 (GRCm39) D1269G probably damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,436,769 (GRCm39) probably benign Het
Fnbp4 T C 2: 90,577,097 (GRCm39) V143A probably damaging Het
Foxo6 A G 4: 120,144,109 (GRCm39) I114T probably damaging Het
Gm6741 T C 17: 91,544,564 (GRCm39) I109T probably benign Het
Gtf2h5 C CA 17: 6,134,833 (GRCm39) probably null Het
Hsf1 C T 15: 76,381,999 (GRCm39) S199L probably damaging Het
Htr3a T C 9: 48,815,981 (GRCm39) N152S probably damaging Het
Ikzf2 T A 1: 69,617,100 (GRCm39) E82D probably benign Het
Kank2 T G 9: 21,705,917 (GRCm39) K367T possibly damaging Het
Kif20b T A 19: 34,916,146 (GRCm39) probably benign Het
Ktn1 G A 14: 47,931,335 (GRCm39) V643I probably benign Het
Lipk G A 19: 33,996,120 (GRCm39) V11M probably benign Het
Med4 T A 14: 73,751,249 (GRCm39) L66* probably null Het
Mtus1 T C 8: 41,451,500 (GRCm39) K379E probably damaging Het
Nat1 T A 8: 67,944,443 (GRCm39) I276N probably damaging Het
Nav2 G A 7: 49,141,184 (GRCm39) V910M possibly damaging Het
Or10ag53 T A 2: 87,082,704 (GRCm39) I141N probably damaging Het
Or4a80 A T 2: 89,582,373 (GRCm39) D266E probably damaging Het
Pcdh9 A G 14: 94,124,583 (GRCm39) V529A probably benign Het
Pcdhga7 C T 18: 37,848,146 (GRCm39) T51I probably benign Het
Pdcd1 A G 1: 93,968,956 (GRCm39) Y121H probably damaging Het
Pdia6 A G 12: 17,333,982 (GRCm39) D438G unknown Het
Pgm1 A G 4: 99,786,964 (GRCm39) T68A probably benign Het
Pik3c2g G A 6: 139,913,619 (GRCm39) V1006I unknown Het
Plk4 C T 3: 40,768,022 (GRCm39) T855I probably damaging Het
Pnldc1 T A 17: 13,111,703 (GRCm39) N335Y probably damaging Het
Prkcq C T 2: 11,304,784 (GRCm39) P658S probably benign Het
Rbl2 T C 8: 91,841,837 (GRCm39) I1011T possibly damaging Het
Rev1 A C 1: 38,127,150 (GRCm39) V370G probably damaging Het
Rtn4 A G 11: 29,643,316 (GRCm39) E43G unknown Het
Rtp2 C T 16: 23,746,064 (GRCm39) G189D possibly damaging Het
Ryr1 G A 7: 28,816,802 (GRCm39) A78V probably benign Het
Sel1l3 A C 5: 53,293,165 (GRCm39) Y850* probably null Het
Senp3 T C 11: 69,564,419 (GRCm39) Q547R probably damaging Het
Siglecf T C 7: 43,004,976 (GRCm39) L402P probably damaging Het
Slc24a1 T C 9: 64,855,453 (GRCm39) I485V probably benign Het
Slc45a2 T A 15: 11,012,610 (GRCm39) H204Q probably benign Het
Slc9a4 T G 1: 40,623,301 (GRCm39) I180S probably damaging Het
Smyd1 T A 6: 71,193,767 (GRCm39) Y420F probably damaging Het
Sorcs1 A G 19: 50,139,658 (GRCm39) I1168T probably benign Het
Syne1 T C 10: 5,033,861 (GRCm39) E7737G possibly damaging Het
Trappc4 T A 9: 44,316,560 (GRCm39) H145L probably benign Het
Wdr75 T A 1: 45,856,560 (GRCm39) W528R probably damaging Het
Zc3h13 T C 14: 75,569,512 (GRCm39) V1453A probably benign Het
Zfp143 T C 7: 109,681,110 (GRCm39) I318T probably benign Het
Zfp846 G A 9: 20,505,352 (GRCm39) R404H possibly damaging Het
Other mutations in Ccser1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Ccser1 APN 6 62,357,126 (GRCm39) missense possibly damaging 0.80
IGL00858:Ccser1 APN 6 61,787,649 (GRCm39) nonsense probably null
IGL01012:Ccser1 APN 6 61,615,474 (GRCm39) missense probably benign 0.01
IGL01391:Ccser1 APN 6 61,615,505 (GRCm39) splice site probably benign
IGL01643:Ccser1 APN 6 61,288,839 (GRCm39) missense probably benign 0.01
IGL01767:Ccser1 APN 6 61,695,136 (GRCm39) missense probably benign 0.03
IGL02081:Ccser1 APN 6 61,288,152 (GRCm39) nonsense probably null
IGL02152:Ccser1 APN 6 61,288,692 (GRCm39) missense possibly damaging 0.57
IGL02870:Ccser1 APN 6 61,288,276 (GRCm39) missense probably damaging 0.99
IGL02890:Ccser1 APN 6 62,356,815 (GRCm39) missense probably damaging 0.99
IGL03147:Ccser1 UTSW 6 61,289,144 (GRCm39) missense probably benign 0.02
R0020:Ccser1 UTSW 6 61,290,788 (GRCm39) missense possibly damaging 0.62
R0831:Ccser1 UTSW 6 61,400,045 (GRCm39) missense probably damaging 0.99
R1306:Ccser1 UTSW 6 62,357,090 (GRCm39) missense probably damaging 0.99
R1441:Ccser1 UTSW 6 62,357,016 (GRCm39) missense probably benign 0.00
R1650:Ccser1 UTSW 6 61,615,474 (GRCm39) missense probably benign 0.01
R1653:Ccser1 UTSW 6 61,288,449 (GRCm39) missense probably benign 0.00
R1913:Ccser1 UTSW 6 62,356,878 (GRCm39) missense probably damaging 0.99
R1961:Ccser1 UTSW 6 61,290,630 (GRCm39) splice site probably benign
R2030:Ccser1 UTSW 6 61,288,547 (GRCm39) missense probably benign
R2056:Ccser1 UTSW 6 61,399,936 (GRCm39) splice site probably null
R2268:Ccser1 UTSW 6 61,547,827 (GRCm39) missense probably damaging 1.00
R2280:Ccser1 UTSW 6 61,547,799 (GRCm39) missense probably damaging 1.00
R2281:Ccser1 UTSW 6 61,547,799 (GRCm39) missense probably damaging 1.00
R2571:Ccser1 UTSW 6 61,399,944 (GRCm39) missense probably damaging 1.00
R4606:Ccser1 UTSW 6 61,288,568 (GRCm39) missense probably damaging 0.99
R4711:Ccser1 UTSW 6 61,288,910 (GRCm39) missense possibly damaging 0.74
R4770:Ccser1 UTSW 6 61,288,485 (GRCm39) missense possibly damaging 0.85
R4932:Ccser1 UTSW 6 61,695,175 (GRCm39) missense possibly damaging 0.78
R5078:Ccser1 UTSW 6 61,288,350 (GRCm39) missense probably damaging 0.97
R5097:Ccser1 UTSW 6 61,289,144 (GRCm39) missense probably benign 0.02
R5221:Ccser1 UTSW 6 61,289,075 (GRCm39) missense probably damaging 0.99
R5378:Ccser1 UTSW 6 61,288,650 (GRCm39) missense probably benign 0.00
R5604:Ccser1 UTSW 6 61,290,788 (GRCm39) missense probably damaging 0.97
R5700:Ccser1 UTSW 6 61,288,260 (GRCm39) missense probably benign 0.00
R5970:Ccser1 UTSW 6 61,288,226 (GRCm39) missense possibly damaging 0.94
R6257:Ccser1 UTSW 6 62,356,769 (GRCm39) missense probably benign
R6257:Ccser1 UTSW 6 61,350,946 (GRCm39) missense probably damaging 0.96
R6375:Ccser1 UTSW 6 61,288,152 (GRCm39) nonsense probably null
R6703:Ccser1 UTSW 6 61,615,495 (GRCm39) nonsense probably null
R6930:Ccser1 UTSW 6 62,357,009 (GRCm39) missense probably benign 0.03
R7256:Ccser1 UTSW 6 61,288,851 (GRCm39) missense probably benign 0.38
R7362:Ccser1 UTSW 6 61,787,864 (GRCm39) missense unknown
R7508:Ccser1 UTSW 6 61,547,707 (GRCm39) missense probably benign 0.05
R7532:Ccser1 UTSW 6 62,356,915 (GRCm39) nonsense probably null
R7533:Ccser1 UTSW 6 61,615,474 (GRCm39) missense probably benign 0.25
R7729:Ccser1 UTSW 6 61,288,840 (GRCm39) missense probably benign
R7875:Ccser1 UTSW 6 61,288,932 (GRCm39) missense probably benign 0.06
R8055:Ccser1 UTSW 6 61,290,757 (GRCm39) missense possibly damaging 0.47
R8396:Ccser1 UTSW 6 61,289,088 (GRCm39) missense probably benign 0.09
R8849:Ccser1 UTSW 6 61,288,537 (GRCm39) missense probably benign 0.00
R8906:Ccser1 UTSW 6 61,787,842 (GRCm39) missense probably benign 0.00
R9058:Ccser1 UTSW 6 61,350,976 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGCACTAACTCGAGCTC -3'
(R):5'- AGCAGCTTCTTGGTGGACTG -3'

Sequencing Primer
(F):5'- CACTAACTCGAGCTCAGGGAG -3'
(R):5'- GACTGTTTAATAGAACGGCGACTTTG -3'
Posted On 2021-03-08