Incidental Mutation 'R8724:Pik3c2g'
ID662279
Institutional Source Beutler Lab
Gene Symbol Pik3c2g
Ensembl Gene ENSMUSG00000030228
Gene Namephosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 gamma
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R8724 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location139587221-139969284 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 139967893 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 1006 (V1006I)
Ref Sequence ENSEMBL: ENSMUSP00000107499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087657] [ENSMUST00000111868] [ENSMUST00000218528]
Predicted Effect probably benign
Transcript: ENSMUST00000087657
AA Change: V638I

PolyPhen 2 Score 0.393 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000084939
Gene: ENSMUSG00000030228
AA Change: V638I

DomainStartEndE-ValueType
PI3Kc 125 387 2.11e-109 SMART
PX 411 515 1.24e-21 SMART
C2 550 647 1.34e-7 SMART
Predicted Effect unknown
Transcript: ENSMUST00000111868
AA Change: V1006I
SMART Domains Protein: ENSMUSP00000107499
Gene: ENSMUSG00000030228
AA Change: V1006I

DomainStartEndE-ValueType
SCOP:d1e8xa2 1 83 4e-16 SMART
PI3Ka 103 288 7.6e-29 SMART
PI3Kc 375 637 2.11e-109 SMART
PX 661 765 1.24e-21 SMART
C2 800 897 1.34e-7 SMART
Predicted Effect unknown
Transcript: ENSMUST00000218528
AA Change: V888I
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. This gene may play a role in several diseases, including type II diabetes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allelel exhibit reduced liver glucogen accumulation, hyperlipidemia, adiposity and insulin resistance with age or after consumption of a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik G A 3: 36,890,893 V334I probably damaging Het
Adamtsl4 C T 3: 95,677,116 R990Q possibly damaging Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Ank2 A T 3: 126,943,756 D2826E unknown Het
Asb3 A T 11: 31,101,120 I486F probably damaging Het
Atg4b A T 1: 93,768,301 Y54F probably damaging Het
Atp1a2 T A 1: 172,279,378 I792F probably benign Het
Ccser1 A C 6: 61,311,215 S121R probably damaging Het
Cdc40 C T 10: 40,841,484 D404N probably damaging Het
Cep120 A T 18: 53,723,127 V406E possibly damaging Het
Ces2g C A 8: 104,966,323 A331D probably benign Het
Csnk1g2 G A 10: 80,638,926 R299H probably damaging Het
Dlat G T 9: 50,649,667 A360E probably damaging Het
Dock10 T G 1: 80,592,627 I371L probably benign Het
Dpp9 T A 17: 56,205,867 T114S probably benign Het
Dusp13 T C 14: 21,746,407 R160G probably benign Het
Edem3 A G 1: 151,775,873 K122R possibly damaging Het
Ehbp1l1 A G 19: 5,715,858 S1486P possibly damaging Het
Elf3 A G 1: 135,254,360 I361T probably damaging Het
Epha3 C T 16: 63,583,455 C761Y probably damaging Het
Ephb2 A G 4: 136,771,057 I237T probably damaging Het
Eya1 A T 1: 14,208,982 D346E probably benign Het
Fat2 T C 11: 55,282,960 Y2309C probably damaging Het
Fbn1 T C 2: 125,360,146 D1269G probably damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,609,203 probably benign Het
Fnbp4 T C 2: 90,746,753 V143A probably damaging Het
Foxo6 A G 4: 120,286,912 I114T probably damaging Het
Gm6741 T C 17: 91,237,136 I109T probably benign Het
Gtf2h5 C CA 17: 6,084,558 probably null Het
Hsf1 C T 15: 76,497,799 S199L probably damaging Het
Htr3a T C 9: 48,904,681 N152S probably damaging Het
Ikzf2 T A 1: 69,577,941 E82D probably benign Het
Kank2 T G 9: 21,794,621 K367T possibly damaging Het
Ktn1 G A 14: 47,693,878 V643I probably benign Het
Lipk G A 19: 34,018,720 V11M probably benign Het
Med4 T A 14: 73,513,809 L66* probably null Het
Mtus1 T C 8: 40,998,463 K379E probably damaging Het
Nat1 T A 8: 67,491,791 I276N probably damaging Het
Nav2 G A 7: 49,491,436 V910M possibly damaging Het
Olfr1115 T A 2: 87,252,360 I141N probably damaging Het
Olfr1253 A T 2: 89,752,029 D266E probably damaging Het
Pcdh9 A G 14: 93,887,147 V529A probably benign Het
Pcdhga7 C T 18: 37,715,093 T51I probably benign Het
Pdcd1 A G 1: 94,041,231 Y121H probably damaging Het
Pdia6 A G 12: 17,283,981 D438G unknown Het
Pgm2 A G 4: 99,929,767 T68A probably benign Het
Plk4 C T 3: 40,813,587 T855I probably damaging Het
Pnldc1 T A 17: 12,892,816 N335Y probably damaging Het
Prkcq C T 2: 11,299,973 P658S probably benign Het
Rbl2 T C 8: 91,115,209 I1011T possibly damaging Het
Rev1 A C 1: 38,088,069 V370G probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,920 probably benign Het
Rtn4 A G 11: 29,693,316 E43G unknown Het
Rtp2 C T 16: 23,927,314 G189D possibly damaging Het
Ryr1 G A 7: 29,117,377 A78V probably benign Het
Sel1l3 A C 5: 53,135,823 Y850* probably null Het
Senp3 T C 11: 69,673,593 Q547R probably damaging Het
Siglecf T C 7: 43,355,552 L402P probably damaging Het
Slc24a1 T C 9: 64,948,171 I485V probably benign Het
Slc45a2 T A 15: 11,012,524 H204Q probably benign Het
Slc9a4 T G 1: 40,584,141 I180S probably damaging Het
Smyd1 T A 6: 71,216,783 Y420F probably damaging Het
Sorcs1 A G 19: 50,151,220 I1168T probably benign Het
Syne1 T C 10: 5,083,861 E7737G possibly damaging Het
Trappc4 T A 9: 44,405,263 H145L probably benign Het
Wdr34 T C 2: 30,033,949 D188G probably benign Het
Wdr75 T A 1: 45,817,400 W528R probably damaging Het
Zc3h13 T C 14: 75,332,072 V1453A probably benign Het
Zfp143 T C 7: 110,081,903 I318T probably benign Het
Zfp846 G A 9: 20,594,056 R404H possibly damaging Het
Other mutations in Pik3c2g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Pik3c2g APN 6 139896125 missense probably damaging 1.00
IGL01355:Pik3c2g APN 6 139852857 missense probably damaging 0.98
IGL01579:Pik3c2g APN 6 139754741 nonsense probably null
IGL01580:Pik3c2g APN 6 139622516 missense probably damaging 0.99
IGL01587:Pik3c2g APN 6 139754741 nonsense probably null
IGL01813:Pik3c2g APN 6 139622409 missense possibly damaging 0.55
IGL02218:Pik3c2g APN 6 139860355 missense probably damaging 1.00
IGL02479:Pik3c2g APN 6 139918004 missense probably benign 0.40
IGL02480:Pik3c2g APN 6 139852800 missense probably damaging 1.00
IGL02721:Pik3c2g APN 6 139736973 missense probably benign 0.15
IGL02967:Pik3c2g APN 6 139967828 missense probably damaging 0.98
IGL03221:Pik3c2g APN 6 139772407 critical splice acceptor site probably null
FR4304:Pik3c2g UTSW 6 139635656 frame shift probably null
FR4340:Pik3c2g UTSW 6 139635656 frame shift probably null
FR4976:Pik3c2g UTSW 6 139635654 frame shift probably null
IGL02837:Pik3c2g UTSW 6 139626564 nonsense probably null
PIT4531001:Pik3c2g UTSW 6 139859370 missense
R0002:Pik3c2g UTSW 6 139768745 missense probably benign 0.08
R0081:Pik3c2g UTSW 6 139957793 missense probably benign 0.05
R0098:Pik3c2g UTSW 6 139662443 missense unknown
R0719:Pik3c2g UTSW 6 139629725 missense probably damaging 1.00
R0740:Pik3c2g UTSW 6 139633793 critical splice donor site probably null
R0837:Pik3c2g UTSW 6 139957699 splice site probably benign
R0840:Pik3c2g UTSW 6 139896072 missense probably damaging 1.00
R1306:Pik3c2g UTSW 6 139772428 missense probably benign
R1501:Pik3c2g UTSW 6 139844070 critical splice donor site probably null
R1591:Pik3c2g UTSW 6 139748178 missense probably benign 0.00
R1666:Pik3c2g UTSW 6 139635636 intron probably benign
R1907:Pik3c2g UTSW 6 139844042 missense probably damaging 1.00
R1970:Pik3c2g UTSW 6 139900386 critical splice donor site probably null
R1982:Pik3c2g UTSW 6 139622548 missense probably damaging 0.97
R2171:Pik3c2g UTSW 6 139855286 nonsense probably null
R2188:Pik3c2g UTSW 6 139852874 missense probably damaging 1.00
R3777:Pik3c2g UTSW 6 139622387 missense probably damaging 1.00
R3778:Pik3c2g UTSW 6 139622387 missense probably damaging 1.00
R3965:Pik3c2g UTSW 6 139855292 missense possibly damaging 0.90
R4076:Pik3c2g UTSW 6 139852863 missense probably damaging 1.00
R4078:Pik3c2g UTSW 6 139635610 intron probably benign
R4108:Pik3c2g UTSW 6 139730370 missense probably benign 0.00
R4461:Pik3c2g UTSW 6 139841681 intron probably benign
R4474:Pik3c2g UTSW 6 139633751 missense probably damaging 0.99
R4509:Pik3c2g UTSW 6 139720006 missense probably benign 0.25
R4646:Pik3c2g UTSW 6 139720018 missense probably benign 0.05
R4732:Pik3c2g UTSW 6 139935985 missense probably benign 0.28
R4733:Pik3c2g UTSW 6 139935985 missense probably benign 0.28
R4854:Pik3c2g UTSW 6 139768779 missense probably damaging 1.00
R4928:Pik3c2g UTSW 6 139967802 missense possibly damaging 0.88
R4959:Pik3c2g UTSW 6 139843931 missense possibly damaging 0.65
R4973:Pik3c2g UTSW 6 139843931 missense possibly damaging 0.65
R5032:Pik3c2g UTSW 6 139896202 missense probably benign 0.00
R5071:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5072:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5073:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5074:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5107:Pik3c2g UTSW 6 139635625 intron probably benign
R5186:Pik3c2g UTSW 6 139622018 missense probably damaging 1.00
R5253:Pik3c2g UTSW 6 139896257 critical splice donor site probably null
R5359:Pik3c2g UTSW 6 139622123 missense probably damaging 1.00
R5394:Pik3c2g UTSW 6 139720082 missense probably benign
R5417:Pik3c2g UTSW 6 139736943 missense probably benign
R5435:Pik3c2g UTSW 6 139715855 splice site probably null
R5580:Pik3c2g UTSW 6 139626533 missense probably damaging 0.99
R5664:Pik3c2g UTSW 6 139737007 missense probably damaging 0.98
R5908:Pik3c2g UTSW 6 139768710 missense
R5914:Pik3c2g UTSW 6 139622479 missense probably benign 0.00
R6046:Pik3c2g UTSW 6 139622139 missense probably damaging 0.96
R6046:Pik3c2g UTSW 6 139896792 missense probably damaging 1.00
R6298:Pik3c2g UTSW 6 139626563 missense probably damaging 1.00
R6382:Pik3c2g UTSW 6 139719998 missense possibly damaging 0.88
R6480:Pik3c2g UTSW 6 139730469 missense probably benign 0.27
R6917:Pik3c2g UTSW 6 139896173 missense probably benign 0.00
R6929:Pik3c2g UTSW 6 139957776 missense possibly damaging 0.67
R7022:Pik3c2g UTSW 6 139622063 missense possibly damaging 0.82
R7144:Pik3c2g UTSW 6 139629870 missense probably damaging 1.00
R7213:Pik3c2g UTSW 6 139860264 missense
R7215:Pik3c2g UTSW 6 139754863 missense
R7332:Pik3c2g UTSW 6 139896255 missense
R7357:Pik3c2g UTSW 6 139633793 critical splice donor site probably null
R7359:Pik3c2g UTSW 6 139967894 missense unknown
R7385:Pik3c2g UTSW 6 139855353 missense
R7455:Pik3c2g UTSW 6 139967917 missense unknown
R7651:Pik3c2g UTSW 6 139622072 missense possibly damaging 0.85
R7888:Pik3c2g UTSW 6 139896744 missense
R7923:Pik3c2g UTSW 6 139633793 critical splice donor site probably null
R7964:Pik3c2g UTSW 6 139882060 missense
R8005:Pik3c2g UTSW 6 139622069 missense probably benign 0.01
R8371:Pik3c2g UTSW 6 139936056 missense unknown
R8733:Pik3c2g UTSW 6 139768700 nonsense probably null
R8809:Pik3c2g UTSW 6 139768710 missense
RF015:Pik3c2g UTSW 6 139754771 missense
RF032:Pik3c2g UTSW 6 139635658 frame shift probably null
X0024:Pik3c2g UTSW 6 139860258 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTCCAAGGTATAAGTTGTTAGC -3'
(R):5'- AAAAGGCAGATTTTGATCTGGTTC -3'

Sequencing Primer
(F):5'- CTCTCCATTTTCAGGTGGTA -3'
(R):5'- ATGGTTTGGGTCACTACAACCAC -3'
Posted On2021-03-08