Incidental Mutation 'R8724:Ryr1'
ID 662280
Institutional Source Beutler Lab
Gene Symbol Ryr1
Ensembl Gene ENSMUSG00000030592
Gene Name ryanodine receptor 1, skeletal muscle
Synonyms calcium release channel isoform 1, Ryr, skrr
MMRRC Submission 068573-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8724 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 28702765-28824599 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 28816802 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 78 (A78V)
Ref Sequence ENSEMBL: ENSMUSP00000149042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032813] [ENSMUST00000179893] [ENSMUST00000214374]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000032813
AA Change: A78V

PolyPhen 2 Score 0.647 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000032813
Gene: ENSMUSG00000030592
AA Change: A78V

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
MIR 99 154 7.52e-4 SMART
MIR 161 206 1.11e-6 SMART
MIR 212 266 1.23e-8 SMART
MIR 272 362 1.05e-25 SMART
Pfam:RYDR_ITPR 441 645 1.2e-73 PFAM
SPRY 660 798 2.79e-27 SMART
Pfam:RyR 851 945 6.5e-33 PFAM
Pfam:RyR 965 1059 1.5e-30 PFAM
SPRY 1086 1209 8.62e-42 SMART
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1340 1349 N/A INTRINSIC
SPRY 1431 1571 3.05e-33 SMART
low complexity region 1787 1798 N/A INTRINSIC
coiled coil region 1871 1932 N/A INTRINSIC
low complexity region 1989 1998 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2069 2092 N/A INTRINSIC
Pfam:RYDR_ITPR 2158 2366 7e-66 PFAM
low complexity region 2390 2404 N/A INTRINSIC
Pfam:RyR 2735 2829 9.7e-34 PFAM
Pfam:RyR 2855 2943 5.7e-32 PFAM
low complexity region 3130 3144 N/A INTRINSIC
low complexity region 3290 3304 N/A INTRINSIC
low complexity region 3375 3394 N/A INTRINSIC
PDB:2BCX|B 3613 3642 2e-13 PDB
low complexity region 3681 3691 N/A INTRINSIC
low complexity region 3735 3760 N/A INTRINSIC
Pfam:RIH_assoc 3872 4004 1.9e-41 PFAM
low complexity region 4010 4023 N/A INTRINSIC
Pfam:EF-hand_8 4085 4136 9.8e-8 PFAM
transmembrane domain 4283 4305 N/A INTRINSIC
transmembrane domain 4318 4336 N/A INTRINSIC
transmembrane domain 4341 4363 N/A INTRINSIC
Pfam:RR_TM4-6 4377 4666 2e-86 PFAM
Pfam:Ion_trans 4761 4932 3.4e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179893
AA Change: A78V

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137123
Gene: ENSMUSG00000030592
AA Change: A78V

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
MIR 99 154 7.52e-4 SMART
MIR 161 206 1.11e-6 SMART
MIR 212 266 1.23e-8 SMART
MIR 272 362 1.05e-25 SMART
Pfam:RYDR_ITPR 443 638 4.5e-63 PFAM
SPRY 660 798 2.79e-27 SMART
Pfam:RyR 852 942 1.3e-37 PFAM
Pfam:RyR 966 1056 1.6e-28 PFAM
SPRY 1086 1209 8.62e-42 SMART
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1340 1349 N/A INTRINSIC
SPRY 1431 1571 3.05e-33 SMART
low complexity region 1787 1798 N/A INTRINSIC
coiled coil region 1871 1932 N/A INTRINSIC
low complexity region 1989 1998 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2069 2092 N/A INTRINSIC
Pfam:RYDR_ITPR 2160 2366 2.2e-68 PFAM
low complexity region 2390 2404 N/A INTRINSIC
Pfam:RyR 2736 2826 7.2e-31 PFAM
Pfam:RyR 2856 2940 5.6e-27 PFAM
low complexity region 3130 3144 N/A INTRINSIC
low complexity region 3290 3304 N/A INTRINSIC
low complexity region 3375 3394 N/A INTRINSIC
PDB:2BCX|B 3615 3644 2e-13 PDB
low complexity region 3683 3693 N/A INTRINSIC
low complexity region 3737 3762 N/A INTRINSIC
Pfam:RIH_assoc 3878 3996 6.2e-35 PFAM
low complexity region 4012 4025 N/A INTRINSIC
Pfam:EF-hand_8 4087 4137 1.8e-8 PFAM
transmembrane domain 4285 4307 N/A INTRINSIC
transmembrane domain 4320 4338 N/A INTRINSIC
transmembrane domain 4343 4365 N/A INTRINSIC
Pfam:RR_TM4-6 4379 4668 8.4e-76 PFAM
Pfam:Ion_trans 4763 4946 2.8e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214374
AA Change: A78V

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ryanodine receptor found in skeletal muscle. The encoded protein functions as a calcium release channel in the sarcoplasmic reticulum but also serves to connect the sarcoplasmic reticulum and transverse tubule. Mutations in this gene are associated with malignant hyperthermia susceptibility, central core disease, and minicore myopathy with external ophthalmoplegia. Alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation and a similar ENU-induced mutation are born with a rounded body shape, edema, thin and misshapened ribs, and abnormal muscle fibers. Mutants die perinatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl4 C T 3: 95,584,426 (GRCm39) R990Q possibly damaging Het
Ampd2 C A 3: 107,987,432 (GRCm39) V134L probably benign Het
Ank2 A T 3: 126,737,405 (GRCm39) D2826E unknown Het
Asb3 A T 11: 31,051,120 (GRCm39) I486F probably damaging Het
Atg4b A T 1: 93,696,023 (GRCm39) Y54F probably damaging Het
Atp1a2 T A 1: 172,106,945 (GRCm39) I792F probably benign Het
Bltp1 G A 3: 36,945,042 (GRCm39) V334I probably damaging Het
Ccser1 A C 6: 61,288,199 (GRCm39) S121R probably damaging Het
Cdc40 C T 10: 40,717,480 (GRCm39) D404N probably damaging Het
Cep120 A T 18: 53,856,199 (GRCm39) V406E possibly damaging Het
Ces2g C A 8: 105,692,955 (GRCm39) A331D probably benign Het
Csnk1g2 G A 10: 80,474,760 (GRCm39) R299H probably damaging Het
Dlat G T 9: 50,560,967 (GRCm39) A360E probably damaging Het
Dock10 T G 1: 80,570,344 (GRCm39) I371L probably benign Het
Dpp9 T A 17: 56,512,867 (GRCm39) T114S probably benign Het
Dusp13b T C 14: 21,796,475 (GRCm39) R160G probably benign Het
Dync2i2 T C 2: 29,923,961 (GRCm39) D188G probably benign Het
Edem3 A G 1: 151,651,624 (GRCm39) K122R possibly damaging Het
Ehbp1l1 A G 19: 5,765,886 (GRCm39) S1486P possibly damaging Het
Elf3 A G 1: 135,182,098 (GRCm39) I361T probably damaging Het
Epha3 C T 16: 63,403,818 (GRCm39) C761Y probably damaging Het
Ephb2 A G 4: 136,498,368 (GRCm39) I237T probably damaging Het
Eya1 A T 1: 14,279,206 (GRCm39) D346E probably benign Het
Fat2 T C 11: 55,173,786 (GRCm39) Y2309C probably damaging Het
Fbn1 T C 2: 125,202,066 (GRCm39) D1269G probably damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,436,769 (GRCm39) probably benign Het
Fnbp4 T C 2: 90,577,097 (GRCm39) V143A probably damaging Het
Foxo6 A G 4: 120,144,109 (GRCm39) I114T probably damaging Het
Gm6741 T C 17: 91,544,564 (GRCm39) I109T probably benign Het
Gtf2h5 C CA 17: 6,134,833 (GRCm39) probably null Het
Hsf1 C T 15: 76,381,999 (GRCm39) S199L probably damaging Het
Htr3a T C 9: 48,815,981 (GRCm39) N152S probably damaging Het
Ikzf2 T A 1: 69,617,100 (GRCm39) E82D probably benign Het
Kank2 T G 9: 21,705,917 (GRCm39) K367T possibly damaging Het
Kif20b T A 19: 34,916,146 (GRCm39) probably benign Het
Ktn1 G A 14: 47,931,335 (GRCm39) V643I probably benign Het
Lipk G A 19: 33,996,120 (GRCm39) V11M probably benign Het
Med4 T A 14: 73,751,249 (GRCm39) L66* probably null Het
Mtus1 T C 8: 41,451,500 (GRCm39) K379E probably damaging Het
Nat1 T A 8: 67,944,443 (GRCm39) I276N probably damaging Het
Nav2 G A 7: 49,141,184 (GRCm39) V910M possibly damaging Het
Or10ag53 T A 2: 87,082,704 (GRCm39) I141N probably damaging Het
Or4a80 A T 2: 89,582,373 (GRCm39) D266E probably damaging Het
Pcdh9 A G 14: 94,124,583 (GRCm39) V529A probably benign Het
Pcdhga7 C T 18: 37,848,146 (GRCm39) T51I probably benign Het
Pdcd1 A G 1: 93,968,956 (GRCm39) Y121H probably damaging Het
Pdia6 A G 12: 17,333,982 (GRCm39) D438G unknown Het
Pgm1 A G 4: 99,786,964 (GRCm39) T68A probably benign Het
Pik3c2g G A 6: 139,913,619 (GRCm39) V1006I unknown Het
Plk4 C T 3: 40,768,022 (GRCm39) T855I probably damaging Het
Pnldc1 T A 17: 13,111,703 (GRCm39) N335Y probably damaging Het
Prkcq C T 2: 11,304,784 (GRCm39) P658S probably benign Het
Rbl2 T C 8: 91,841,837 (GRCm39) I1011T possibly damaging Het
Rev1 A C 1: 38,127,150 (GRCm39) V370G probably damaging Het
Rtn4 A G 11: 29,643,316 (GRCm39) E43G unknown Het
Rtp2 C T 16: 23,746,064 (GRCm39) G189D possibly damaging Het
Sel1l3 A C 5: 53,293,165 (GRCm39) Y850* probably null Het
Senp3 T C 11: 69,564,419 (GRCm39) Q547R probably damaging Het
Siglecf T C 7: 43,004,976 (GRCm39) L402P probably damaging Het
Slc24a1 T C 9: 64,855,453 (GRCm39) I485V probably benign Het
Slc45a2 T A 15: 11,012,610 (GRCm39) H204Q probably benign Het
Slc9a4 T G 1: 40,623,301 (GRCm39) I180S probably damaging Het
Smyd1 T A 6: 71,193,767 (GRCm39) Y420F probably damaging Het
Sorcs1 A G 19: 50,139,658 (GRCm39) I1168T probably benign Het
Syne1 T C 10: 5,033,861 (GRCm39) E7737G possibly damaging Het
Trappc4 T A 9: 44,316,560 (GRCm39) H145L probably benign Het
Wdr75 T A 1: 45,856,560 (GRCm39) W528R probably damaging Het
Zc3h13 T C 14: 75,569,512 (GRCm39) V1453A probably benign Het
Zfp143 T C 7: 109,681,110 (GRCm39) I318T probably benign Het
Zfp846 G A 9: 20,505,352 (GRCm39) R404H possibly damaging Het
Other mutations in Ryr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Ryr1 APN 7 28,802,235 (GRCm39) missense probably damaging 1.00
IGL00335:Ryr1 APN 7 28,824,385 (GRCm39) splice site probably null
IGL00427:Ryr1 APN 7 28,804,162 (GRCm39) splice site probably benign
IGL00559:Ryr1 APN 7 28,711,667 (GRCm39) splice site probably benign
IGL00803:Ryr1 APN 7 28,769,070 (GRCm39) missense possibly damaging 0.95
IGL00886:Ryr1 APN 7 28,723,654 (GRCm39) missense probably damaging 1.00
IGL00948:Ryr1 APN 7 28,719,620 (GRCm39) missense possibly damaging 0.78
IGL01017:Ryr1 APN 7 28,781,968 (GRCm39) missense probably damaging 0.99
IGL01116:Ryr1 APN 7 28,799,627 (GRCm39) splice site probably benign
IGL01385:Ryr1 APN 7 28,756,410 (GRCm39) missense probably damaging 1.00
IGL01482:Ryr1 APN 7 28,751,762 (GRCm39) missense probably damaging 1.00
IGL01529:Ryr1 APN 7 28,774,652 (GRCm39) missense probably damaging 1.00
IGL01543:Ryr1 APN 7 28,790,501 (GRCm39) missense probably damaging 1.00
IGL01653:Ryr1 APN 7 28,778,022 (GRCm39) missense probably damaging 0.99
IGL01701:Ryr1 APN 7 28,759,235 (GRCm39) missense probably damaging 0.98
IGL02051:Ryr1 APN 7 28,771,083 (GRCm39) missense probably benign 0.16
IGL02152:Ryr1 APN 7 28,751,440 (GRCm39) missense possibly damaging 0.95
IGL02271:Ryr1 APN 7 28,793,472 (GRCm39) missense probably benign 0.07
IGL02321:Ryr1 APN 7 28,778,121 (GRCm39) missense probably damaging 1.00
IGL02448:Ryr1 APN 7 28,804,491 (GRCm39) splice site probably benign
IGL02472:Ryr1 APN 7 28,740,269 (GRCm39) missense probably damaging 1.00
IGL02544:Ryr1 APN 7 28,815,024 (GRCm39) missense probably benign 0.24
IGL02666:Ryr1 APN 7 28,719,188 (GRCm39) missense unknown
IGL02672:Ryr1 APN 7 28,703,944 (GRCm39) unclassified probably benign
IGL02677:Ryr1 APN 7 28,810,033 (GRCm39) missense probably benign 0.18
IGL02686:Ryr1 APN 7 28,768,975 (GRCm39) splice site probably benign
IGL02751:Ryr1 APN 7 28,778,199 (GRCm39) missense probably damaging 1.00
IGL02899:Ryr1 APN 7 28,748,220 (GRCm39) missense possibly damaging 0.53
IGL02926:Ryr1 APN 7 28,760,965 (GRCm39) missense probably damaging 1.00
IGL02950:Ryr1 APN 7 28,796,884 (GRCm39) missense probably damaging 1.00
IGL02960:Ryr1 APN 7 28,759,478 (GRCm39) missense probably damaging 1.00
IGL02968:Ryr1 APN 7 28,743,318 (GRCm39) missense probably damaging 1.00
IGL03070:Ryr1 APN 7 28,770,084 (GRCm39) missense probably damaging 1.00
IGL03091:Ryr1 APN 7 28,782,911 (GRCm39) missense possibly damaging 0.85
IGL03100:Ryr1 APN 7 28,804,018 (GRCm39) missense probably damaging 1.00
IGL03107:Ryr1 APN 7 28,774,624 (GRCm39) missense probably damaging 1.00
IGL03117:Ryr1 APN 7 28,802,389 (GRCm39) missense probably damaging 1.00
IGL03118:Ryr1 APN 7 28,715,211 (GRCm39) missense unknown
IGL03146:Ryr1 APN 7 28,793,457 (GRCm39) missense probably benign 0.09
IGL03165:Ryr1 APN 7 28,804,465 (GRCm39) missense probably benign 0.22
IGL03220:Ryr1 APN 7 28,759,280 (GRCm39) missense probably damaging 1.00
R0017:Ryr1 UTSW 7 28,746,967 (GRCm39) missense probably damaging 1.00
R0066:Ryr1 UTSW 7 28,704,992 (GRCm39) unclassified probably benign
R0066:Ryr1 UTSW 7 28,704,992 (GRCm39) unclassified probably benign
R0069:Ryr1 UTSW 7 28,809,930 (GRCm39) splice site probably benign
R0148:Ryr1 UTSW 7 28,751,460 (GRCm39) missense probably damaging 0.99
R0266:Ryr1 UTSW 7 28,740,104 (GRCm39) missense probably damaging 1.00
R0346:Ryr1 UTSW 7 28,767,013 (GRCm39) splice site probably benign
R0387:Ryr1 UTSW 7 28,782,792 (GRCm39) splice site probably benign
R0454:Ryr1 UTSW 7 28,735,500 (GRCm39) missense probably damaging 0.99
R0494:Ryr1 UTSW 7 28,703,218 (GRCm39) splice site probably benign
R0533:Ryr1 UTSW 7 28,778,205 (GRCm39) missense probably damaging 1.00
R0585:Ryr1 UTSW 7 28,735,501 (GRCm39) missense probably damaging 1.00
R0591:Ryr1 UTSW 7 28,804,220 (GRCm39) missense possibly damaging 0.68
R0624:Ryr1 UTSW 7 28,774,034 (GRCm39) missense probably damaging 1.00
R0662:Ryr1 UTSW 7 28,799,614 (GRCm39) missense probably damaging 1.00
R0849:Ryr1 UTSW 7 28,740,104 (GRCm39) missense probably damaging 1.00
R0961:Ryr1 UTSW 7 28,709,122 (GRCm39) missense unknown
R1052:Ryr1 UTSW 7 28,795,683 (GRCm39) missense probably damaging 0.96
R1218:Ryr1 UTSW 7 28,785,534 (GRCm39) missense possibly damaging 0.79
R1340:Ryr1 UTSW 7 28,815,437 (GRCm39) missense probably damaging 0.99
R1513:Ryr1 UTSW 7 28,770,046 (GRCm39) missense probably damaging 1.00
R1543:Ryr1 UTSW 7 28,782,962 (GRCm39) missense possibly damaging 0.67
R1566:Ryr1 UTSW 7 28,791,600 (GRCm39) missense possibly damaging 0.95
R1572:Ryr1 UTSW 7 28,761,616 (GRCm39) missense probably damaging 1.00
R1623:Ryr1 UTSW 7 28,794,915 (GRCm39) missense probably damaging 1.00
R1632:Ryr1 UTSW 7 28,793,686 (GRCm39) missense probably benign 0.03
R1661:Ryr1 UTSW 7 28,801,163 (GRCm39) missense probably damaging 0.98
R1665:Ryr1 UTSW 7 28,735,503 (GRCm39) missense probably damaging 1.00
R1678:Ryr1 UTSW 7 28,815,579 (GRCm39) missense probably damaging 0.99
R1705:Ryr1 UTSW 7 28,777,989 (GRCm39) missense probably damaging 1.00
R1712:Ryr1 UTSW 7 28,746,928 (GRCm39) missense probably benign 0.25
R1720:Ryr1 UTSW 7 28,801,295 (GRCm39) missense probably damaging 0.99
R1799:Ryr1 UTSW 7 28,767,046 (GRCm39) missense probably damaging 1.00
R1847:Ryr1 UTSW 7 28,779,236 (GRCm39) missense probably benign 0.43
R1860:Ryr1 UTSW 7 28,708,977 (GRCm39) missense unknown
R1861:Ryr1 UTSW 7 28,708,977 (GRCm39) missense unknown
R1921:Ryr1 UTSW 7 28,754,369 (GRCm39) missense probably damaging 1.00
R1983:Ryr1 UTSW 7 28,758,897 (GRCm39) missense possibly damaging 0.74
R2043:Ryr1 UTSW 7 28,759,056 (GRCm39) missense probably damaging 0.99
R2089:Ryr1 UTSW 7 28,785,474 (GRCm39) missense probably damaging 1.00
R2091:Ryr1 UTSW 7 28,785,474 (GRCm39) missense probably damaging 1.00
R2091:Ryr1 UTSW 7 28,785,474 (GRCm39) missense probably damaging 1.00
R2105:Ryr1 UTSW 7 28,789,575 (GRCm39) missense probably damaging 0.99
R2175:Ryr1 UTSW 7 28,767,867 (GRCm39) missense probably damaging 1.00
R2259:Ryr1 UTSW 7 28,719,166 (GRCm39) missense unknown
R2291:Ryr1 UTSW 7 28,798,202 (GRCm39) missense probably damaging 1.00
R2351:Ryr1 UTSW 7 28,774,718 (GRCm39) missense probably benign 0.18
R2512:Ryr1 UTSW 7 28,802,967 (GRCm39) missense possibly damaging 0.64
R2571:Ryr1 UTSW 7 28,735,551 (GRCm39) missense possibly damaging 0.94
R2571:Ryr1 UTSW 7 28,708,987 (GRCm39) missense unknown
R2885:Ryr1 UTSW 7 28,774,223 (GRCm39) missense probably damaging 0.99
R2886:Ryr1 UTSW 7 28,774,223 (GRCm39) missense probably damaging 0.99
R2889:Ryr1 UTSW 7 28,778,166 (GRCm39) missense possibly damaging 0.76
R3051:Ryr1 UTSW 7 28,752,515 (GRCm39) missense probably damaging 1.00
R3052:Ryr1 UTSW 7 28,752,515 (GRCm39) missense probably damaging 1.00
R3053:Ryr1 UTSW 7 28,752,515 (GRCm39) missense probably damaging 1.00
R3082:Ryr1 UTSW 7 28,745,071 (GRCm39) missense probably damaging 1.00
R3103:Ryr1 UTSW 7 28,774,373 (GRCm39) missense probably damaging 1.00
R3237:Ryr1 UTSW 7 28,769,075 (GRCm39) critical splice acceptor site probably null
R3551:Ryr1 UTSW 7 28,756,422 (GRCm39) missense probably damaging 1.00
R3552:Ryr1 UTSW 7 28,756,422 (GRCm39) missense probably damaging 1.00
R3807:Ryr1 UTSW 7 28,719,577 (GRCm39) missense probably damaging 1.00
R3815:Ryr1 UTSW 7 28,772,327 (GRCm39) missense probably damaging 0.98
R4010:Ryr1 UTSW 7 28,794,549 (GRCm39) missense probably benign 0.41
R4041:Ryr1 UTSW 7 28,785,356 (GRCm39) missense possibly damaging 0.77
R4226:Ryr1 UTSW 7 28,761,576 (GRCm39) nonsense probably null
R4257:Ryr1 UTSW 7 28,781,875 (GRCm39) missense possibly damaging 0.93
R4328:Ryr1 UTSW 7 28,782,484 (GRCm39) missense probably damaging 1.00
R4394:Ryr1 UTSW 7 28,793,667 (GRCm39) missense possibly damaging 0.69
R4485:Ryr1 UTSW 7 28,789,581 (GRCm39) missense probably damaging 0.97
R4550:Ryr1 UTSW 7 28,798,160 (GRCm39) missense probably benign 0.05
R4554:Ryr1 UTSW 7 28,804,433 (GRCm39) missense probably benign 0.03
R4562:Ryr1 UTSW 7 28,774,005 (GRCm39) intron probably benign
R4642:Ryr1 UTSW 7 28,785,463 (GRCm39) missense possibly damaging 0.91
R4669:Ryr1 UTSW 7 28,759,256 (GRCm39) missense probably null 0.99
R4707:Ryr1 UTSW 7 28,745,087 (GRCm39) missense probably damaging 1.00
R4766:Ryr1 UTSW 7 28,785,258 (GRCm39) missense probably damaging 0.96
R4768:Ryr1 UTSW 7 28,704,246 (GRCm39) unclassified probably benign
R4770:Ryr1 UTSW 7 28,808,707 (GRCm39) missense probably damaging 0.99
R4780:Ryr1 UTSW 7 28,794,522 (GRCm39) missense possibly damaging 0.85
R4927:Ryr1 UTSW 7 28,719,408 (GRCm39) missense unknown
R4933:Ryr1 UTSW 7 28,803,723 (GRCm39) missense probably damaging 1.00
R4934:Ryr1 UTSW 7 28,767,520 (GRCm39) missense probably damaging 1.00
R4942:Ryr1 UTSW 7 28,768,998 (GRCm39) missense probably damaging 0.98
R4960:Ryr1 UTSW 7 28,778,208 (GRCm39) missense possibly damaging 0.82
R5007:Ryr1 UTSW 7 28,768,540 (GRCm39) missense probably damaging 1.00
R5011:Ryr1 UTSW 7 28,802,234 (GRCm39) splice site probably null
R5013:Ryr1 UTSW 7 28,802,234 (GRCm39) splice site probably null
R5137:Ryr1 UTSW 7 28,801,283 (GRCm39) missense possibly damaging 0.94
R5167:Ryr1 UTSW 7 28,767,118 (GRCm39) missense probably damaging 1.00
R5239:Ryr1 UTSW 7 28,735,553 (GRCm39) missense probably damaging 1.00
R5291:Ryr1 UTSW 7 28,815,023 (GRCm39) missense probably benign 0.03
R5303:Ryr1 UTSW 7 28,767,907 (GRCm39) missense probably damaging 1.00
R5386:Ryr1 UTSW 7 28,816,841 (GRCm39) missense probably damaging 0.98
R5431:Ryr1 UTSW 7 28,809,237 (GRCm39) missense probably benign 0.39
R5460:Ryr1 UTSW 7 28,771,386 (GRCm39) missense probably damaging 1.00
R5463:Ryr1 UTSW 7 28,723,448 (GRCm39) missense possibly damaging 0.79
R5503:Ryr1 UTSW 7 28,768,453 (GRCm39) missense possibly damaging 0.87
R5541:Ryr1 UTSW 7 28,785,610 (GRCm39) missense probably damaging 1.00
R5573:Ryr1 UTSW 7 28,715,148 (GRCm39) missense unknown
R5575:Ryr1 UTSW 7 28,778,118 (GRCm39) missense possibly damaging 0.77
R5610:Ryr1 UTSW 7 28,811,399 (GRCm39) missense probably benign 0.05
R5658:Ryr1 UTSW 7 28,790,514 (GRCm39) splice site probably null
R5918:Ryr1 UTSW 7 28,708,577 (GRCm39) missense probably benign 0.39
R5926:Ryr1 UTSW 7 28,803,785 (GRCm39) missense probably damaging 1.00
R5938:Ryr1 UTSW 7 28,746,290 (GRCm39) missense probably damaging 1.00
R5939:Ryr1 UTSW 7 28,815,552 (GRCm39) missense probably damaging 0.97
R5947:Ryr1 UTSW 7 28,771,349 (GRCm39) missense probably null 0.98
R5991:Ryr1 UTSW 7 28,804,035 (GRCm39) missense probably damaging 0.99
R5992:Ryr1 UTSW 7 28,767,062 (GRCm39) missense probably damaging 1.00
R5996:Ryr1 UTSW 7 28,723,666 (GRCm39) missense probably benign 0.38
R6075:Ryr1 UTSW 7 28,786,863 (GRCm39) missense probably damaging 1.00
R6091:Ryr1 UTSW 7 28,771,398 (GRCm39) missense probably benign 0.01
R6126:Ryr1 UTSW 7 28,775,664 (GRCm39) missense probably null 1.00
R6147:Ryr1 UTSW 7 28,785,339 (GRCm39) missense possibly damaging 0.88
R6235:Ryr1 UTSW 7 28,815,606 (GRCm39) missense probably benign 0.07
R6279:Ryr1 UTSW 7 28,786,853 (GRCm39) missense possibly damaging 0.93
R6381:Ryr1 UTSW 7 28,774,682 (GRCm39) missense possibly damaging 0.87
R6441:Ryr1 UTSW 7 28,759,120 (GRCm39) missense possibly damaging 0.95
R6443:Ryr1 UTSW 7 28,776,503 (GRCm39) missense probably damaging 0.97
R6459:Ryr1 UTSW 7 28,715,079 (GRCm39) missense probably benign 0.39
R6514:Ryr1 UTSW 7 28,746,266 (GRCm39) missense probably damaging 1.00
R6563:Ryr1 UTSW 7 28,794,917 (GRCm39) missense possibly damaging 0.92
R6660:Ryr1 UTSW 7 28,737,770 (GRCm39) critical splice donor site probably null
R6746:Ryr1 UTSW 7 28,816,829 (GRCm39) missense possibly damaging 0.56
R6785:Ryr1 UTSW 7 28,764,299 (GRCm39) missense probably benign 0.12
R6800:Ryr1 UTSW 7 28,723,741 (GRCm39) missense possibly damaging 0.95
R6939:Ryr1 UTSW 7 28,751,751 (GRCm39) missense possibly damaging 0.91
R6980:Ryr1 UTSW 7 28,808,812 (GRCm39) missense probably benign 0.03
R6995:Ryr1 UTSW 7 28,793,607 (GRCm39) missense probably damaging 0.97
R7065:Ryr1 UTSW 7 28,803,068 (GRCm39) missense probably damaging 1.00
R7123:Ryr1 UTSW 7 28,746,279 (GRCm39) missense probably benign 0.37
R7238:Ryr1 UTSW 7 28,794,807 (GRCm39) missense probably benign 0.24
R7240:Ryr1 UTSW 7 28,751,440 (GRCm39) missense possibly damaging 0.95
R7300:Ryr1 UTSW 7 28,758,936 (GRCm39) missense probably damaging 1.00
R7365:Ryr1 UTSW 7 28,785,180 (GRCm39) missense probably benign 0.05
R7403:Ryr1 UTSW 7 28,713,292 (GRCm39) missense probably benign 0.34
R7422:Ryr1 UTSW 7 28,785,295 (GRCm39) missense probably benign 0.00
R7493:Ryr1 UTSW 7 28,794,630 (GRCm39) missense probably benign 0.44
R7570:Ryr1 UTSW 7 28,778,010 (GRCm39) missense probably damaging 0.98
R7593:Ryr1 UTSW 7 28,735,528 (GRCm39) missense probably damaging 1.00
R7769:Ryr1 UTSW 7 28,798,210 (GRCm39) missense probably damaging 1.00
R7781:Ryr1 UTSW 7 28,767,055 (GRCm39) missense probably damaging 1.00
R7790:Ryr1 UTSW 7 28,804,257 (GRCm39) missense probably benign 0.39
R7799:Ryr1 UTSW 7 28,702,985 (GRCm39) splice site probably null
R7916:Ryr1 UTSW 7 28,790,364 (GRCm39) nonsense probably null
R7922:Ryr1 UTSW 7 28,796,649 (GRCm39) missense probably benign 0.09
R7988:Ryr1 UTSW 7 28,795,596 (GRCm39) missense probably benign 0.29
R7997:Ryr1 UTSW 7 28,702,968 (GRCm39) missense unknown
R8052:Ryr1 UTSW 7 28,782,810 (GRCm39) missense probably benign 0.05
R8096:Ryr1 UTSW 7 28,708,626 (GRCm39) missense unknown
R8116:Ryr1 UTSW 7 28,810,308 (GRCm39) missense probably benign 0.03
R8202:Ryr1 UTSW 7 28,790,457 (GRCm39) missense probably benign 0.18
R8207:Ryr1 UTSW 7 28,789,650 (GRCm39) missense probably damaging 1.00
R8248:Ryr1 UTSW 7 28,768,546 (GRCm39) missense probably damaging 1.00
R8257:Ryr1 UTSW 7 28,764,064 (GRCm39) missense possibly damaging 0.82
R8354:Ryr1 UTSW 7 28,715,142 (GRCm39) missense unknown
R8454:Ryr1 UTSW 7 28,715,142 (GRCm39) missense unknown
R8487:Ryr1 UTSW 7 28,740,292 (GRCm39) missense probably damaging 0.97
R8529:Ryr1 UTSW 7 28,769,509 (GRCm39) missense possibly damaging 0.86
R8545:Ryr1 UTSW 7 28,704,239 (GRCm39) unclassified probably benign
R8678:Ryr1 UTSW 7 28,776,489 (GRCm39) missense probably damaging 0.99
R8717:Ryr1 UTSW 7 28,751,753 (GRCm39) missense probably benign 0.03
R8755:Ryr1 UTSW 7 28,791,693 (GRCm39) missense probably benign 0.19
R8772:Ryr1 UTSW 7 28,815,557 (GRCm39) missense probably benign 0.05
R8790:Ryr1 UTSW 7 28,776,297 (GRCm39) missense probably damaging 1.00
R8793:Ryr1 UTSW 7 28,764,284 (GRCm39) missense probably damaging 1.00
R8836:Ryr1 UTSW 7 28,774,091 (GRCm39) missense probably damaging 1.00
R8858:Ryr1 UTSW 7 28,808,638 (GRCm39) missense probably benign 0.00
R8910:Ryr1 UTSW 7 28,771,340 (GRCm39) missense probably damaging 1.00
R8920:Ryr1 UTSW 7 28,789,640 (GRCm39) missense possibly damaging 0.89
R8938:Ryr1 UTSW 7 28,801,358 (GRCm39) missense probably damaging 1.00
R9035:Ryr1 UTSW 7 28,790,422 (GRCm39) missense probably damaging 0.97
R9115:Ryr1 UTSW 7 28,803,989 (GRCm39) nonsense probably null
R9123:Ryr1 UTSW 7 28,771,229 (GRCm39) missense probably damaging 1.00
R9154:Ryr1 UTSW 7 28,769,283 (GRCm39) missense probably benign 0.08
R9189:Ryr1 UTSW 7 28,776,471 (GRCm39) missense probably damaging 1.00
R9200:Ryr1 UTSW 7 28,794,524 (GRCm39) missense probably benign 0.00
R9214:Ryr1 UTSW 7 28,785,187 (GRCm39) missense possibly damaging 0.52
R9216:Ryr1 UTSW 7 28,801,277 (GRCm39) missense probably damaging 0.97
R9240:Ryr1 UTSW 7 28,743,313 (GRCm39) missense probably damaging 1.00
R9261:Ryr1 UTSW 7 28,751,813 (GRCm39) missense possibly damaging 0.91
R9276:Ryr1 UTSW 7 28,802,254 (GRCm39) missense probably damaging 0.99
R9280:Ryr1 UTSW 7 28,802,389 (GRCm39) missense probably damaging 1.00
R9316:Ryr1 UTSW 7 28,717,387 (GRCm39) missense unknown
R9333:Ryr1 UTSW 7 28,774,214 (GRCm39) critical splice donor site probably null
R9459:Ryr1 UTSW 7 28,768,068 (GRCm39) missense probably damaging 1.00
R9468:Ryr1 UTSW 7 28,772,510 (GRCm39) missense probably damaging 1.00
R9486:Ryr1 UTSW 7 28,777,965 (GRCm39) missense probably benign 0.15
R9524:Ryr1 UTSW 7 28,723,600 (GRCm39) missense probably damaging 1.00
R9620:Ryr1 UTSW 7 28,715,138 (GRCm39) missense unknown
R9664:Ryr1 UTSW 7 28,759,092 (GRCm39) missense probably damaging 1.00
R9776:Ryr1 UTSW 7 28,774,664 (GRCm39) missense probably damaging 1.00
X0021:Ryr1 UTSW 7 28,760,956 (GRCm39) missense probably damaging 1.00
Z1176:Ryr1 UTSW 7 28,802,923 (GRCm39) missense probably damaging 1.00
Z1176:Ryr1 UTSW 7 28,785,460 (GRCm39) missense probably benign 0.10
Z1176:Ryr1 UTSW 7 28,719,639 (GRCm39) missense probably damaging 1.00
Z1177:Ryr1 UTSW 7 28,801,347 (GRCm39) missense probably damaging 1.00
Z1177:Ryr1 UTSW 7 28,748,217 (GRCm39) nonsense probably null
Z1177:Ryr1 UTSW 7 28,717,410 (GRCm39) missense unknown
Z1186:Ryr1 UTSW 7 28,781,902 (GRCm39) missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- TACCCACTTATCCAAATTGAGGG -3'
(R):5'- TCCTGTGTTGTTGGCAAAGC -3'

Sequencing Primer
(F):5'- CACTTATCCAAATTGAGGGCCTGTG -3'
(R):5'- CAAAGCTTTGATGTGTGTGATGCC -3'
Posted On 2021-03-08