Incidental Mutation 'R8725:Knl1'
ID 662324
Institutional Source Beutler Lab
Gene Symbol Knl1
Ensembl Gene ENSMUSG00000027326
Gene Name kinetochore scaffold 1
Synonyms Casc5, 2310043D08Rik, 5730505K17Rik
MMRRC Submission 068574-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8725 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 118877600-118935982 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 118899524 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 408 (F408L)
Ref Sequence ENSEMBL: ENSMUSP00000118646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028799] [ENSMUST00000028802] [ENSMUST00000099542] [ENSMUST00000152380] [ENSMUST00000153300]
AlphaFold Q66JQ7
Predicted Effect probably benign
Transcript: ENSMUST00000028799
AA Change: F408L

PolyPhen 2 Score 0.340 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000028799
Gene: ENSMUSG00000027326
AA Change: F408L

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
PDB:4A1G|H 126 175 1e-13 PDB
low complexity region 426 433 N/A INTRINSIC
low complexity region 883 894 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000028802
AA Change: F408L

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000028802
Gene: ENSMUSG00000027326
AA Change: F408L

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
internal_repeat_1 98 304 1.57e-6 PROSPERO
low complexity region 426 433 N/A INTRINSIC
internal_repeat_1 610 824 1.57e-6 PROSPERO
low complexity region 883 894 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
low complexity region 1621 1644 N/A INTRINSIC
coiled coil region 1724 1755 N/A INTRINSIC
low complexity region 1836 1850 N/A INTRINSIC
low complexity region 1864 1878 N/A INTRINSIC
PDB:4NF9|B 1899 2119 1e-115 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000099542
AA Change: F408L

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097140
Gene: ENSMUSG00000027326
AA Change: F408L

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
internal_repeat_1 98 304 1.57e-6 PROSPERO
low complexity region 426 433 N/A INTRINSIC
internal_repeat_1 610 824 1.57e-6 PROSPERO
low complexity region 883 894 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
low complexity region 1621 1644 N/A INTRINSIC
coiled coil region 1724 1755 N/A INTRINSIC
low complexity region 1836 1850 N/A INTRINSIC
low complexity region 1864 1878 N/A INTRINSIC
PDB:4NF9|B 1899 2119 1e-115 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000152380
AA Change: F408L

PolyPhen 2 Score 0.340 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000118646
Gene: ENSMUSG00000027326
AA Change: F408L

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
PDB:4A1G|H 126 175 3e-14 PDB
low complexity region 426 433 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153300
SMART Domains Protein: ENSMUSP00000120905
Gene: ENSMUSG00000027326

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the multiprotein assembly that is required for creation of kinetochore-microtubule attachments and chromosome segregation. The encoded protein functions as a scaffold for proteins that influence the spindle assembly checkpoint during the eukaryotic cell cycle and it interacts with at least five different kinetochore proteins and two checkpoint kinases. In adults, this gene is predominantly expressed in normal testes, various cancer cell lines and primary tumors from other tissues and is ubiquitously expressed in fetal tissues. This gene was originally identified as a fusion partner with the mixed-lineage leukemia (MLL) gene in t(11;15)(q23;q14). Mutations in this gene cause autosomal recessive primary microcephaly-4 (MCPH4). Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described but their biological validity has not been confirmed. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E6. Mice homozygous for an ENU-induced allele exhibit possible embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630089N07Rik C T 16: 97,867,651 (GRCm39) A104T probably damaging Het
Abhd18 T A 3: 40,884,627 (GRCm39) L222Q probably damaging Het
Adam30 C T 3: 98,070,348 (GRCm39) T727M possibly damaging Het
Adh6b A T 3: 138,058,729 (GRCm39) Q137L probably damaging Het
Alpl C T 4: 137,475,127 (GRCm39) V269I probably benign Het
Ang2 C T 14: 51,432,996 (GRCm39) G129S probably benign Het
Atp6v0a1 A T 11: 100,920,015 (GRCm39) H216L possibly damaging Het
BC030500 C T 8: 59,366,049 (GRCm39) T61I unknown Het
Brpf1 T G 6: 113,293,491 (GRCm39) L520R probably damaging Het
Btbd10 A G 7: 112,927,626 (GRCm39) I243T possibly damaging Het
Bub1 C A 2: 127,646,139 (GRCm39) C947F probably damaging Het
C4b T C 17: 34,953,459 (GRCm39) E1008G probably damaging Het
Ccdc40 A G 11: 119,155,323 (GRCm39) T1188A probably benign Het
Cdcp3 A G 7: 130,875,485 (GRCm39) T1770A unknown Het
Cnn1 G T 9: 22,010,557 (GRCm39) probably benign Het
Colgalt2 T C 1: 152,360,662 (GRCm39) M233T probably damaging Het
Cox15 A T 19: 43,735,181 (GRCm39) C195* probably null Het
Cped1 A T 6: 22,059,941 (GRCm39) R202S possibly damaging Het
Dact2 A T 17: 14,417,146 (GRCm39) C351* probably null Het
Dbnl A G 11: 5,738,582 (GRCm39) N8S probably benign Het
Depdc1a T A 3: 159,228,356 (GRCm39) N369K probably benign Het
Dnah2 A T 11: 69,415,005 (GRCm39) L243Q probably damaging Het
Dscaml1 T A 9: 45,341,759 (GRCm39) Y57N probably benign Het
Eif2b3 A G 4: 116,927,944 (GRCm39) T388A probably benign Het
Eif4h A C 5: 134,654,393 (GRCm39) probably null Het
Elf1 C T 14: 79,810,667 (GRCm39) Q288* probably null Het
Fgl2 C T 5: 21,580,677 (GRCm39) R340* probably null Het
Fut4 T C 9: 14,662,082 (GRCm39) D404G probably damaging Het
Glmn G A 5: 107,718,152 (GRCm39) P255L probably benign Het
Gm14322 C T 2: 177,411,481 (GRCm39) T97I probably benign Het
Gm44511 C A 6: 128,797,997 (GRCm39) C32F probably damaging Het
Gm5478 A G 15: 101,553,871 (GRCm39) F247S probably damaging Het
Golgb1 T A 16: 36,739,563 (GRCm39) M2675K probably damaging Het
Hectd1 T C 12: 51,849,000 (GRCm39) D368G possibly damaging Het
Hnrnpul2 A G 19: 8,798,064 (GRCm39) N140S probably benign Het
Htr4 A T 18: 62,561,209 (GRCm39) I157L probably damaging Het
Kcnma1 T G 14: 23,436,332 (GRCm39) M790L probably benign Het
Kcnv1 G A 15: 44,977,999 (GRCm39) S13L unknown Het
Kctd20 C T 17: 29,184,025 (GRCm39) R312* probably null Het
Kdm3b T A 18: 34,960,435 (GRCm39) I1340N probably damaging Het
Kdm6b A G 11: 69,292,919 (GRCm39) F1286L unknown Het
Lypd5 G T 7: 24,053,101 (GRCm39) G253W probably damaging Het
Mea1 A G 17: 46,992,614 (GRCm39) T21A probably benign Het
Metrnl A G 11: 121,606,842 (GRCm39) E299G possibly damaging Het
Muc5ac C T 7: 141,363,481 (GRCm39) probably benign Het
Nbn G A 4: 15,963,911 (GRCm39) S104N probably damaging Het
Nxpe2 A T 9: 48,238,073 (GRCm39) F61I probably benign Het
Or6c1b T C 10: 129,273,334 (GRCm39) Y218H probably benign Het
Or6c70 T A 10: 129,710,092 (GRCm39) D178V probably damaging Het
Pgr C A 9: 8,901,544 (GRCm39) P359Q probably damaging Het
Pi4k2b G A 5: 52,908,031 (GRCm39) V157I probably benign Het
Plekhm1 A C 11: 103,258,444 (GRCm39) F1031L probably damaging Het
Pltp A G 2: 164,696,301 (GRCm39) S124P probably damaging Het
Polr3gl T A 3: 96,487,154 (GRCm39) E177V probably benign Het
Pstk G T 7: 130,973,024 (GRCm39) R41L possibly damaging Het
Rasgrp1 T C 2: 117,119,158 (GRCm39) E493G probably benign Het
Rtn3 A G 19: 7,434,726 (GRCm39) L422P probably benign Het
Rusc2 C T 4: 43,401,351 (GRCm39) probably benign Het
Sbno2 A G 10: 79,911,090 (GRCm39) F6S probably benign Het
Sh2d4a A G 8: 68,798,695 (GRCm39) Y348C probably damaging Het
Sh3rf3 A G 10: 58,939,992 (GRCm39) probably null Het
Sipa1l2 T C 8: 126,177,125 (GRCm39) E1163G probably benign Het
Strip1 G C 3: 107,521,964 (GRCm39) A738G probably damaging Het
Tdrkh C T 3: 94,333,299 (GRCm39) R255C probably benign Het
Tln1 A T 4: 43,555,911 (GRCm39) M101K possibly damaging Het
Trav6-2 A C 14: 52,905,028 (GRCm39) probably benign Het
Tspan11 A T 6: 127,900,674 (GRCm39) I82F possibly damaging Het
Ttn T C 2: 76,779,320 (GRCm39) K1233E unknown Het
Usp29 A T 7: 6,965,917 (GRCm39) S587C probably damaging Het
Vmn1r235 A T 17: 21,482,056 (GRCm39) Q127L probably damaging Het
Vmn1r65 C A 7: 6,011,503 (GRCm39) A244S probably damaging Het
Vmn2r18 A G 5: 151,508,462 (GRCm39) S221P probably damaging Het
Zfp229 T C 17: 21,964,828 (GRCm39) S353P probably damaging Het
Zpld2 T C 4: 133,930,150 (GRCm39) K52E probably benign Het
Other mutations in Knl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Knl1 APN 2 118,894,564 (GRCm39) missense probably damaging 0.96
IGL00582:Knl1 APN 2 118,932,980 (GRCm39) missense probably benign 0.19
IGL00666:Knl1 APN 2 118,900,945 (GRCm39) missense probably damaging 0.96
IGL01062:Knl1 APN 2 118,907,461 (GRCm39) missense probably benign 0.33
IGL01395:Knl1 APN 2 118,902,047 (GRCm39) missense probably damaging 0.96
IGL01604:Knl1 APN 2 118,900,482 (GRCm39) missense probably damaging 1.00
IGL01996:Knl1 APN 2 118,934,542 (GRCm39) missense probably damaging 1.00
IGL02086:Knl1 APN 2 118,931,255 (GRCm39) missense probably benign 0.40
IGL02105:Knl1 APN 2 118,902,289 (GRCm39) missense probably benign
IGL02106:Knl1 APN 2 118,902,489 (GRCm39) missense possibly damaging 0.89
IGL02201:Knl1 APN 2 118,899,633 (GRCm39) missense probably benign 0.01
IGL02252:Knl1 APN 2 118,903,021 (GRCm39) missense probably damaging 1.00
IGL02414:Knl1 APN 2 118,900,804 (GRCm39) missense possibly damaging 0.83
IGL02655:Knl1 APN 2 118,901,473 (GRCm39) missense possibly damaging 0.62
IGL02682:Knl1 APN 2 118,908,450 (GRCm39) missense possibly damaging 0.86
IGL02710:Knl1 APN 2 118,901,411 (GRCm39) missense probably damaging 0.99
IGL02877:Knl1 APN 2 118,919,312 (GRCm39) missense probably benign 0.08
IGL03100:Knl1 APN 2 118,931,251 (GRCm39) missense probably damaging 0.99
IGL03210:Knl1 APN 2 118,901,098 (GRCm39) missense probably benign 0.02
IGL03138:Knl1 UTSW 2 118,902,840 (GRCm39) missense probably damaging 0.96
R0023:Knl1 UTSW 2 118,933,030 (GRCm39) missense possibly damaging 0.73
R0064:Knl1 UTSW 2 118,906,724 (GRCm39) missense probably benign 0.00
R0064:Knl1 UTSW 2 118,906,724 (GRCm39) missense probably benign 0.00
R0078:Knl1 UTSW 2 118,900,373 (GRCm39) missense probably benign 0.16
R0178:Knl1 UTSW 2 118,888,886 (GRCm39) splice site probably benign
R0295:Knl1 UTSW 2 118,919,320 (GRCm39) missense probably damaging 1.00
R0433:Knl1 UTSW 2 118,934,542 (GRCm39) missense probably damaging 0.96
R0453:Knl1 UTSW 2 118,898,869 (GRCm39) missense probably damaging 1.00
R0569:Knl1 UTSW 2 118,927,916 (GRCm39) missense possibly damaging 0.95
R0827:Knl1 UTSW 2 118,919,382 (GRCm39) splice site probably benign
R0920:Knl1 UTSW 2 118,900,309 (GRCm39) missense probably benign 0.00
R1120:Knl1 UTSW 2 118,892,856 (GRCm39) missense probably damaging 0.99
R1155:Knl1 UTSW 2 118,901,635 (GRCm39) missense possibly damaging 0.90
R1204:Knl1 UTSW 2 118,901,670 (GRCm39) missense probably benign 0.00
R1241:Knl1 UTSW 2 118,903,054 (GRCm39) missense probably benign 0.03
R1387:Knl1 UTSW 2 118,901,211 (GRCm39) missense possibly damaging 0.93
R1448:Knl1 UTSW 2 118,898,788 (GRCm39) missense probably damaging 1.00
R1469:Knl1 UTSW 2 118,901,827 (GRCm39) missense possibly damaging 0.73
R1469:Knl1 UTSW 2 118,901,827 (GRCm39) missense possibly damaging 0.73
R1719:Knl1 UTSW 2 118,902,219 (GRCm39) missense probably benign 0.01
R1721:Knl1 UTSW 2 118,906,815 (GRCm39) missense probably damaging 1.00
R2128:Knl1 UTSW 2 118,902,300 (GRCm39) missense possibly damaging 0.79
R2170:Knl1 UTSW 2 118,918,075 (GRCm39) critical splice donor site probably null
R2227:Knl1 UTSW 2 118,902,481 (GRCm39) missense probably damaging 0.97
R2246:Knl1 UTSW 2 118,902,708 (GRCm39) missense probably damaging 1.00
R2275:Knl1 UTSW 2 118,902,762 (GRCm39) missense probably damaging 0.99
R2508:Knl1 UTSW 2 118,888,849 (GRCm39) nonsense probably null
R3115:Knl1 UTSW 2 118,900,872 (GRCm39) missense possibly damaging 0.53
R3122:Knl1 UTSW 2 118,899,425 (GRCm39) missense probably benign 0.32
R3431:Knl1 UTSW 2 118,892,843 (GRCm39) missense probably damaging 1.00
R3755:Knl1 UTSW 2 118,933,060 (GRCm39) missense probably damaging 1.00
R4461:Knl1 UTSW 2 118,890,080 (GRCm39) missense probably benign 0.00
R4600:Knl1 UTSW 2 118,901,025 (GRCm39) missense possibly damaging 0.90
R4713:Knl1 UTSW 2 118,899,618 (GRCm39) nonsense probably null
R4758:Knl1 UTSW 2 118,902,213 (GRCm39) frame shift probably null
R4762:Knl1 UTSW 2 118,902,417 (GRCm39) missense probably benign 0.01
R4869:Knl1 UTSW 2 118,902,832 (GRCm39) missense possibly damaging 0.73
R4870:Knl1 UTSW 2 118,911,994 (GRCm39) missense probably benign 0.22
R4935:Knl1 UTSW 2 118,899,438 (GRCm39) missense possibly damaging 0.50
R5167:Knl1 UTSW 2 118,900,512 (GRCm39) missense probably damaging 1.00
R5184:Knl1 UTSW 2 118,899,657 (GRCm39) missense probably damaging 1.00
R5293:Knl1 UTSW 2 118,900,176 (GRCm39) missense probably damaging 0.99
R5326:Knl1 UTSW 2 118,898,829 (GRCm39) missense possibly damaging 0.66
R5331:Knl1 UTSW 2 118,900,736 (GRCm39) missense possibly damaging 0.92
R5353:Knl1 UTSW 2 118,901,464 (GRCm39) missense probably benign 0.01
R5493:Knl1 UTSW 2 118,899,211 (GRCm39) missense probably damaging 0.98
R5542:Knl1 UTSW 2 118,898,829 (GRCm39) missense possibly damaging 0.66
R5632:Knl1 UTSW 2 118,900,833 (GRCm39) missense probably damaging 1.00
R5650:Knl1 UTSW 2 118,912,031 (GRCm39) nonsense probably null
R5854:Knl1 UTSW 2 118,900,884 (GRCm39) missense probably benign 0.02
R5979:Knl1 UTSW 2 118,899,841 (GRCm39) missense possibly damaging 0.83
R6086:Knl1 UTSW 2 118,924,549 (GRCm39) missense probably damaging 1.00
R6283:Knl1 UTSW 2 118,900,767 (GRCm39) missense probably damaging 1.00
R6285:Knl1 UTSW 2 118,902,422 (GRCm39) missense probably damaging 1.00
R6313:Knl1 UTSW 2 118,899,799 (GRCm39) missense probably damaging 1.00
R6419:Knl1 UTSW 2 118,899,484 (GRCm39) missense probably benign 0.02
R6608:Knl1 UTSW 2 118,917,093 (GRCm39) missense probably damaging 0.99
R6881:Knl1 UTSW 2 118,925,665 (GRCm39) missense possibly damaging 0.67
R7161:Knl1 UTSW 2 118,901,266 (GRCm39) missense possibly damaging 0.79
R7206:Knl1 UTSW 2 118,899,780 (GRCm39) missense probably benign 0.35
R7270:Knl1 UTSW 2 118,933,003 (GRCm39) missense possibly damaging 0.53
R7276:Knl1 UTSW 2 118,902,167 (GRCm39) missense probably damaging 0.98
R7358:Knl1 UTSW 2 118,901,040 (GRCm39) missense possibly damaging 0.92
R7402:Knl1 UTSW 2 118,925,707 (GRCm39) nonsense probably null
R7408:Knl1 UTSW 2 118,901,073 (GRCm39) missense possibly damaging 0.54
R7475:Knl1 UTSW 2 118,918,027 (GRCm39) missense probably damaging 1.00
R7516:Knl1 UTSW 2 118,901,179 (GRCm39) missense probably damaging 0.99
R7524:Knl1 UTSW 2 118,896,460 (GRCm39) missense probably damaging 1.00
R7559:Knl1 UTSW 2 118,924,487 (GRCm39) missense possibly damaging 0.84
R7607:Knl1 UTSW 2 118,925,614 (GRCm39) missense possibly damaging 0.93
R7745:Knl1 UTSW 2 118,902,037 (GRCm39) missense probably benign 0.13
R7847:Knl1 UTSW 2 118,901,457 (GRCm39) missense probably benign 0.02
R8423:Knl1 UTSW 2 118,900,513 (GRCm39) missense probably damaging 1.00
R8727:Knl1 UTSW 2 118,899,524 (GRCm39) missense probably benign 0.34
R8995:Knl1 UTSW 2 118,902,990 (GRCm39) missense probably benign 0.11
R9023:Knl1 UTSW 2 118,900,761 (GRCm39) missense probably benign 0.27
R9100:Knl1 UTSW 2 118,899,469 (GRCm39) missense probably benign 0.02
R9102:Knl1 UTSW 2 118,917,973 (GRCm39) missense probably benign 0.22
R9303:Knl1 UTSW 2 118,898,829 (GRCm39) missense possibly damaging 0.83
R9400:Knl1 UTSW 2 118,931,224 (GRCm39) missense probably damaging 0.98
R9426:Knl1 UTSW 2 118,899,979 (GRCm39) missense possibly damaging 0.81
R9583:Knl1 UTSW 2 118,887,782 (GRCm39) missense probably damaging 1.00
R9616:Knl1 UTSW 2 118,907,425 (GRCm39) missense probably damaging 1.00
R9616:Knl1 UTSW 2 118,899,994 (GRCm39) missense probably benign 0.02
R9671:Knl1 UTSW 2 118,901,089 (GRCm39) missense probably damaging 1.00
R9766:Knl1 UTSW 2 118,900,381 (GRCm39) missense probably damaging 1.00
R9782:Knl1 UTSW 2 118,899,910 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGGCTCTTTCCCAAACCCTG -3'
(R):5'- TAAGATTTCGGAGCACCATTTCC -3'

Sequencing Primer
(F):5'- TTTCCCAAACCCTGAAAATAAAATTC -3'
(R):5'- ATTATCTATTGCAACGGTGTGAC -3'
Posted On 2021-03-08