Incidental Mutation 'R8725:Rusc2'
ID662336
Institutional Source Beutler Lab
Gene Symbol Rusc2
Ensembl Gene ENSMUSG00000035969
Gene NameRUN and SH3 domain containing 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.217) question?
Stock #R8725 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location43381979-43427088 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to T at 43401351 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035645] [ENSMUST00000125399] [ENSMUST00000135216] [ENSMUST00000136360] [ENSMUST00000144911] [ENSMUST00000152322]
Predicted Effect probably benign
Transcript: ENSMUST00000035645
SMART Domains Protein: ENSMUSP00000038379
Gene: ENSMUSG00000035969

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
low complexity region 435 448 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 600 617 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
RUN 1109 1177 3.66e-21 SMART
low complexity region 1235 1260 N/A INTRINSIC
low complexity region 1289 1324 N/A INTRINSIC
low complexity region 1330 1341 N/A INTRINSIC
SH3 1457 1512 7.4e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125399
Predicted Effect probably benign
Transcript: ENSMUST00000135216
Predicted Effect probably benign
Transcript: ENSMUST00000136360
SMART Domains Protein: ENSMUSP00000123431
Gene: ENSMUSG00000035969

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144911
Predicted Effect probably benign
Transcript: ENSMUST00000152322
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a RUN and SH3 domain containing protein that interacts with Rab1b and Rab1-binding protein GM130. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A G 7: 131,273,756 T1770A unknown Het
A630089N07Rik C T 16: 98,066,451 A104T probably damaging Het
Abhd18 T A 3: 40,930,192 L222Q probably damaging Het
Adam30 C T 3: 98,163,032 T727M possibly damaging Het
Adh6b A T 3: 138,352,968 Q137L probably damaging Het
Alpl C T 4: 137,747,816 V269I probably benign Het
Ang2 C T 14: 51,195,539 G129S probably benign Het
Atp6v0a1 A T 11: 101,029,189 H216L possibly damaging Het
BC030500 C T 8: 58,913,015 T61I unknown Het
Brpf1 T G 6: 113,316,530 L520R probably damaging Het
Btbd10 A G 7: 113,328,419 I243T possibly damaging Het
Bub1 C A 2: 127,804,219 C947F probably damaging Het
C4b T C 17: 34,734,485 E1008G probably damaging Het
Ccdc40 A G 11: 119,264,497 T1188A probably benign Het
Cnn1 G T 9: 22,099,261 probably benign Het
Colgalt2 T C 1: 152,484,911 M233T probably damaging Het
Cox15 A T 19: 43,746,742 C195* probably null Het
Cped1 A T 6: 22,059,942 R202S possibly damaging Het
Dact2 A T 17: 14,196,884 C351* probably null Het
Dbnl A G 11: 5,788,582 N8S probably benign Het
Depdc1a T A 3: 159,522,719 N369K probably benign Het
Dnah2 A T 11: 69,524,179 L243Q probably damaging Het
Dscaml1 T A 9: 45,430,461 Y57N probably benign Het
Eif2b3 A G 4: 117,070,747 T388A probably benign Het
Eif4h A C 5: 134,625,539 probably null Het
Elf1 C T 14: 79,573,227 Q288* probably null Het
Fgl2 C T 5: 21,375,679 R340* probably null Het
Fut4 T C 9: 14,750,786 D404G probably damaging Het
Glmn G A 5: 107,570,286 P255L probably benign Het
Gm14322 C T 2: 177,769,688 T97I probably benign Het
Gm44511 C A 6: 128,821,034 C32F probably damaging Het
Gm5478 A G 15: 101,645,436 F247S probably damaging Het
Gm7534 T C 4: 134,202,839 K52E probably benign Het
Golgb1 T A 16: 36,919,201 M2675K probably damaging Het
Hectd1 T C 12: 51,802,217 D368G possibly damaging Het
Hnrnpul2 A G 19: 8,820,700 N140S probably benign Het
Htr4 A T 18: 62,428,138 I157L probably damaging Het
Kcnma1 T G 14: 23,386,264 M790L probably benign Het
Kcnv1 G A 15: 45,114,603 S13L unknown Het
Kctd20 C T 17: 28,965,051 R312* probably null Het
Kdm3b T A 18: 34,827,382 I1340N probably damaging Het
Kdm6b A G 11: 69,402,093 F1286L unknown Het
Knl1 T A 2: 119,069,043 F408L probably benign Het
Lypd5 G T 7: 24,353,676 G253W probably damaging Het
Mea1 A G 17: 46,681,688 T21A probably benign Het
Metrnl A G 11: 121,716,016 E299G possibly damaging Het
Muc5ac C T 7: 141,809,744 probably benign Het
Nbn G A 4: 15,963,911 S104N probably damaging Het
Nxpe2 A T 9: 48,326,773 F61I probably benign Het
Olfr786 T C 10: 129,437,465 Y218H probably benign Het
Olfr814 T A 10: 129,874,223 D178V probably damaging Het
Pgr C A 9: 8,901,543 P359Q probably damaging Het
Pi4k2b G A 5: 52,750,689 V157I probably benign Het
Plekhm1 A C 11: 103,367,618 F1031L probably damaging Het
Pltp A G 2: 164,854,381 S124P probably damaging Het
Polr3gl T A 3: 96,579,838 E177V probably benign Het
Pstk G T 7: 131,371,295 R41L possibly damaging Het
Rasgrp1 T C 2: 117,288,677 E493G probably benign Het
Rtn3 A G 19: 7,457,361 L422P probably benign Het
Sbno2 A G 10: 80,075,256 F6S probably benign Het
Sh2d4a A G 8: 68,346,043 Y348C probably damaging Het
Sh3rf3 A G 10: 59,104,170 probably null Het
Sipa1l2 T C 8: 125,450,386 E1163G probably benign Het
Strip1 G C 3: 107,614,648 A738G probably damaging Het
Tdrkh C T 3: 94,425,992 R255C probably benign Het
Tln1 A T 4: 43,555,911 M101K possibly damaging Het
Trav6-2 A C 14: 52,667,571 probably benign Het
Tspan11 A T 6: 127,923,711 I82F possibly damaging Het
Ttn T C 2: 76,948,976 K1233E unknown Het
Usp29 A T 7: 6,962,918 S587C probably damaging Het
Vmn1r235 A T 17: 21,261,794 Q127L probably damaging Het
Vmn1r65 C A 7: 6,008,504 A244S probably damaging Het
Vmn2r18 A G 5: 151,584,997 S221P probably damaging Het
Zfp229 T C 17: 21,745,847 S353P probably damaging Het
Other mutations in Rusc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Rusc2 APN 4 43426116 missense probably damaging 0.97
IGL01474:Rusc2 APN 4 43416434 missense probably damaging 0.98
IGL01541:Rusc2 APN 4 43415840 missense probably benign 0.08
IGL01628:Rusc2 APN 4 43425729 missense probably damaging 1.00
IGL01969:Rusc2 APN 4 43415738 missense probably benign 0.02
IGL02030:Rusc2 APN 4 43416095 missense possibly damaging 0.86
IGL02079:Rusc2 APN 4 43425668 missense probably benign
IGL02115:Rusc2 APN 4 43426136 splice site probably benign
IGL02122:Rusc2 APN 4 43421685 missense possibly damaging 0.67
IGL02350:Rusc2 APN 4 43425351 missense possibly damaging 0.86
IGL02357:Rusc2 APN 4 43425351 missense possibly damaging 0.86
IGL02437:Rusc2 APN 4 43415545 missense probably damaging 1.00
IGL02930:Rusc2 APN 4 43416376 missense probably damaging 0.99
IGL03154:Rusc2 APN 4 43425806 missense probably benign 0.00
P0026:Rusc2 UTSW 4 43415840 missense possibly damaging 0.93
R0036:Rusc2 UTSW 4 43424009 missense probably damaging 1.00
R0068:Rusc2 UTSW 4 43424100 splice site probably benign
R0068:Rusc2 UTSW 4 43424100 splice site probably benign
R0114:Rusc2 UTSW 4 43422055 missense probably damaging 1.00
R0255:Rusc2 UTSW 4 43423954 missense probably damaging 1.00
R0471:Rusc2 UTSW 4 43425486 missense probably damaging 0.99
R1381:Rusc2 UTSW 4 43416137 missense probably damaging 1.00
R1413:Rusc2 UTSW 4 43416568 missense probably benign 0.00
R1416:Rusc2 UTSW 4 43421617 missense possibly damaging 0.86
R1731:Rusc2 UTSW 4 43426046 missense probably benign
R1864:Rusc2 UTSW 4 43421719 missense possibly damaging 0.49
R1897:Rusc2 UTSW 4 43421749 missense probably damaging 1.00
R2010:Rusc2 UTSW 4 43415212 missense probably benign 0.06
R2212:Rusc2 UTSW 4 43415935 missense probably damaging 1.00
R2275:Rusc2 UTSW 4 43416260 missense probably damaging 1.00
R2885:Rusc2 UTSW 4 43415456 missense probably benign 0.28
R2886:Rusc2 UTSW 4 43415456 missense probably benign 0.28
R3412:Rusc2 UTSW 4 43415935 missense probably damaging 1.00
R3413:Rusc2 UTSW 4 43415935 missense probably damaging 1.00
R3414:Rusc2 UTSW 4 43415935 missense probably damaging 1.00
R3852:Rusc2 UTSW 4 43416424 missense probably benign 0.45
R4135:Rusc2 UTSW 4 43425563 missense possibly damaging 0.49
R4272:Rusc2 UTSW 4 43415533 missense probably damaging 1.00
R4574:Rusc2 UTSW 4 43416080 missense probably damaging 0.99
R4888:Rusc2 UTSW 4 43423942 missense probably damaging 1.00
R5010:Rusc2 UTSW 4 43415926 missense probably damaging 1.00
R5071:Rusc2 UTSW 4 43415240 missense probably benign 0.05
R5131:Rusc2 UTSW 4 43414948 missense probably benign 0.03
R5177:Rusc2 UTSW 4 43421805 splice site probably null
R5540:Rusc2 UTSW 4 43423975 missense probably damaging 1.00
R5561:Rusc2 UTSW 4 43415932 nonsense probably null
R5628:Rusc2 UTSW 4 43425348 missense probably damaging 1.00
R5645:Rusc2 UTSW 4 43425758 missense probably benign 0.06
R6129:Rusc2 UTSW 4 43424271 missense probably damaging 1.00
R6362:Rusc2 UTSW 4 43416416 missense probably benign 0.30
R6633:Rusc2 UTSW 4 43414852 missense probably damaging 0.99
R6980:Rusc2 UTSW 4 43422846 missense probably benign 0.35
R7491:Rusc2 UTSW 4 43426528 missense probably damaging 1.00
R7641:Rusc2 UTSW 4 43425335 missense possibly damaging 0.84
R7698:Rusc2 UTSW 4 43414900 nonsense probably null
R7710:Rusc2 UTSW 4 43416119 missense probably benign 0.07
R8052:Rusc2 UTSW 4 43421851 missense probably benign
R8061:Rusc2 UTSW 4 43422492 missense probably damaging 1.00
R8127:Rusc2 UTSW 4 43423747 missense possibly damaging 0.54
R8319:Rusc2 UTSW 4 43425378 missense probably damaging 1.00
R8355:Rusc2 UTSW 4 43422846 missense probably benign 0.35
R8397:Rusc2 UTSW 4 43424206 missense possibly damaging 0.95
R8455:Rusc2 UTSW 4 43422846 missense probably benign 0.35
R8553:Rusc2 UTSW 4 43416508 missense probably benign 0.05
R8725:Rusc2 UTSW 4 43415396 missense probably damaging 0.99
R8727:Rusc2 UTSW 4 43401351 intron probably benign
X0025:Rusc2 UTSW 4 43422226 missense probably benign 0.00
X0066:Rusc2 UTSW 4 43422204 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTACAGCTCTGGACAAGCCG -3'
(R):5'- ATCAGGAGACTAGGCGAGACTC -3'

Sequencing Primer
(F):5'- AGCTCTGGACAAGCCGATTGG -3'
(R):5'- GCGAGACTCAAGTCCTACCTTG -3'
Posted On2021-03-08