Incidental Mutation 'R8725:Tln1'
ID 662337
Institutional Source Beutler Lab
Gene Symbol Tln1
Ensembl Gene ENSMUSG00000028465
Gene Name talin 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8725 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 43531519-43562691 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 43555911 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 101 (M101K)
Ref Sequence ENSEMBL: ENSMUSP00000030187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030187] [ENSMUST00000130353]
AlphaFold P26039
PDB Structure Crystal Structure of Talin Rod 482-655 [X-RAY DIFFRACTION]
Crystal Structure of talin residues 482-789 [X-RAY DIFFRACTION]
Vinculin complexed with the VBS1 helix from talin [X-RAY DIFFRACTION]
Solution structure of VBS2 fragment of talin [SOLUTION NMR]
Structural basis for phosphatidylinositol phosphate kinase type I-gamma binding to talin at focal adhesions [X-RAY DIFFRACTION]
Vinculin Head (0-258) in Complex with the Talin Rod residues 1630-1652 [X-RAY DIFFRACTION]
Solution structure of VBS3 fragment of talin [SOLUTION NMR]
NMR structure of talin-PTB in complex with PIPKI [SOLUTION NMR]
NMR structure of the talin C-terminal actin binding site [SOLUTION NMR]
NMR structure of the talin rod domain, 1655-1822 [SOLUTION NMR]
>> 16 additional structures at PDB <<
Predicted Effect possibly damaging
Transcript: ENSMUST00000030187
AA Change: M101K

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000030187
Gene: ENSMUSG00000028465
AA Change: M101K

DomainStartEndE-ValueType
Blast:B41 2 76 5e-31 BLAST
B41 82 313 4.66e-73 SMART
IRS 308 401 7.65e-16 SMART
Pfam:Talin_middle 491 652 8.2e-60 PFAM
low complexity region 671 690 N/A INTRINSIC
internal_repeat_2 699 760 8.94e-6 PROSPERO
low complexity region 766 775 N/A INTRINSIC
PDB:1ZVZ|B 820 844 2e-7 PDB
low complexity region 866 879 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
PDB:2LQG|A 913 1044 2e-44 PDB
PDB:2L7N|A 1046 1207 1e-101 PDB
Pfam:VBS 1234 1358 9.6e-8 PFAM
internal_repeat_2 1488 1549 8.94e-6 PROSPERO
internal_repeat_3 1623 1769 4.92e-5 PROSPERO
low complexity region 1817 1828 N/A INTRINSIC
Pfam:VBS 1849 1973 6.2e-67 PFAM
PDB:3DYJ|B 1974 2293 N/A PDB
low complexity region 2305 2327 N/A INTRINSIC
ILWEQ 2336 2533 2.93e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125509
SMART Domains Protein: ENSMUSP00000115681
Gene: ENSMUSG00000028465

DomainStartEndE-ValueType
Blast:IRS 2 28 2e-9 BLAST
PDB:2G35|A 2 29 3e-11 PDB
Pfam:Talin_middle 32 193 1.8e-61 PFAM
PDB:2L7A|A 215 279 1e-38 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000130353
AA Change: M101K

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000119441
Gene: ENSMUSG00000028465
AA Change: M101K

DomainStartEndE-ValueType
Blast:B41 1 39 9e-7 BLAST
B41 82 241 6.58e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein that is concentrated in areas of cell-substratum and cell-cell contacts. The encoded protein plays a significant role in the assembly of actin filaments and in spreading and migration of various cell types, including fibroblasts and osteoclasts. It codistributes with integrins in the cell surface membrane in order to assist in the attachment of adherent cells to extracellular matrices and of lymphocytes to other cells. The N-terminus of this protein contains elements for localization to cell-extracellular matrix junctions. The C-terminus contains binding sites for proteins such as beta-1-integrin, actin, and vinculin. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for either one of two knock-out alleles display early developmental anomalies, reduced embryo size, and embryonic lethality due to impaired cell migration at the gastrulation stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A G 7: 131,273,756 T1770A unknown Het
A630089N07Rik C T 16: 98,066,451 A104T probably damaging Het
Abhd18 T A 3: 40,930,192 L222Q probably damaging Het
Adam30 C T 3: 98,163,032 T727M possibly damaging Het
Adh6b A T 3: 138,352,968 Q137L probably damaging Het
Alpl C T 4: 137,747,816 V269I probably benign Het
Ang2 C T 14: 51,195,539 G129S probably benign Het
Atp6v0a1 A T 11: 101,029,189 H216L possibly damaging Het
BC030500 C T 8: 58,913,015 T61I unknown Het
Brpf1 T G 6: 113,316,530 L520R probably damaging Het
Btbd10 A G 7: 113,328,419 I243T possibly damaging Het
Bub1 C A 2: 127,804,219 C947F probably damaging Het
C4b T C 17: 34,734,485 E1008G probably damaging Het
Ccdc40 A G 11: 119,264,497 T1188A probably benign Het
Cnn1 G T 9: 22,099,261 probably benign Het
Colgalt2 T C 1: 152,484,911 M233T probably damaging Het
Cox15 A T 19: 43,746,742 C195* probably null Het
Cped1 A T 6: 22,059,942 R202S possibly damaging Het
Dact2 A T 17: 14,196,884 C351* probably null Het
Dbnl A G 11: 5,788,582 N8S probably benign Het
Depdc1a T A 3: 159,522,719 N369K probably benign Het
Dnah2 A T 11: 69,524,179 L243Q probably damaging Het
Dscaml1 T A 9: 45,430,461 Y57N probably benign Het
Eif2b3 A G 4: 117,070,747 T388A probably benign Het
Eif4h A C 5: 134,625,539 probably null Het
Elf1 C T 14: 79,573,227 Q288* probably null Het
Fgl2 C T 5: 21,375,679 R340* probably null Het
Fut4 T C 9: 14,750,786 D404G probably damaging Het
Glmn G A 5: 107,570,286 P255L probably benign Het
Gm14322 C T 2: 177,769,688 T97I probably benign Het
Gm44511 C A 6: 128,821,034 C32F probably damaging Het
Gm5478 A G 15: 101,645,436 F247S probably damaging Het
Gm7534 T C 4: 134,202,839 K52E probably benign Het
Golgb1 T A 16: 36,919,201 M2675K probably damaging Het
Hectd1 T C 12: 51,802,217 D368G possibly damaging Het
Hnrnpul2 A G 19: 8,820,700 N140S probably benign Het
Htr4 A T 18: 62,428,138 I157L probably damaging Het
Kcnma1 T G 14: 23,386,264 M790L probably benign Het
Kcnv1 G A 15: 45,114,603 S13L unknown Het
Kctd20 C T 17: 28,965,051 R312* probably null Het
Kdm3b T A 18: 34,827,382 I1340N probably damaging Het
Kdm6b A G 11: 69,402,093 F1286L unknown Het
Knl1 T A 2: 119,069,043 F408L probably benign Het
Lypd5 G T 7: 24,353,676 G253W probably damaging Het
Mea1 A G 17: 46,681,688 T21A probably benign Het
Metrnl A G 11: 121,716,016 E299G possibly damaging Het
Muc5ac C T 7: 141,809,744 probably benign Het
Nbn G A 4: 15,963,911 S104N probably damaging Het
Nxpe2 A T 9: 48,326,773 F61I probably benign Het
Olfr786 T C 10: 129,437,465 Y218H probably benign Het
Olfr814 T A 10: 129,874,223 D178V probably damaging Het
Pgr C A 9: 8,901,543 P359Q probably damaging Het
Pi4k2b G A 5: 52,750,689 V157I probably benign Het
Plekhm1 A C 11: 103,367,618 F1031L probably damaging Het
Pltp A G 2: 164,854,381 S124P probably damaging Het
Polr3gl T A 3: 96,579,838 E177V probably benign Het
Pstk G T 7: 131,371,295 R41L possibly damaging Het
Rasgrp1 T C 2: 117,288,677 E493G probably benign Het
Rtn3 A G 19: 7,457,361 L422P probably benign Het
Rusc2 C T 4: 43,401,351 probably benign Het
Sbno2 A G 10: 80,075,256 F6S probably benign Het
Sh2d4a A G 8: 68,346,043 Y348C probably damaging Het
Sh3rf3 A G 10: 59,104,170 probably null Het
Sipa1l2 T C 8: 125,450,386 E1163G probably benign Het
Strip1 G C 3: 107,614,648 A738G probably damaging Het
Tdrkh C T 3: 94,425,992 R255C probably benign Het
Trav6-2 A C 14: 52,667,571 probably benign Het
Tspan11 A T 6: 127,923,711 I82F possibly damaging Het
Ttn T C 2: 76,948,976 K1233E unknown Het
Usp29 A T 7: 6,962,918 S587C probably damaging Het
Vmn1r235 A T 17: 21,261,794 Q127L probably damaging Het
Vmn1r65 C A 7: 6,008,504 A244S probably damaging Het
Vmn2r18 A G 5: 151,584,997 S221P probably damaging Het
Zfp229 T C 17: 21,745,847 S353P probably damaging Het
Other mutations in Tln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Tln1 APN 4 43542719 missense probably benign 0.22
IGL00987:Tln1 APN 4 43551297 unclassified probably benign
IGL01345:Tln1 APN 4 43536281 missense probably damaging 1.00
IGL01456:Tln1 APN 4 43543432 unclassified probably benign
IGL01715:Tln1 APN 4 43555890 missense probably damaging 1.00
IGL01750:Tln1 APN 4 43545435 missense probably damaging 1.00
IGL01933:Tln1 APN 4 43539508 missense probably benign
IGL01933:Tln1 APN 4 43555894 missense possibly damaging 0.52
IGL02119:Tln1 APN 4 43546760 missense probably damaging 0.99
IGL02148:Tln1 APN 4 43555388 missense probably damaging 1.00
IGL02153:Tln1 APN 4 43546857 missense possibly damaging 0.76
IGL02522:Tln1 APN 4 43540612 missense probably benign 0.07
IGL02691:Tln1 APN 4 43539544 missense probably benign 0.42
IGL02882:Tln1 APN 4 43539522 missense probably benign 0.45
IGL02892:Tln1 APN 4 43555679 missense probably damaging 1.00
IGL03061:Tln1 APN 4 43545694 missense probably damaging 1.00
IGL03102:Tln1 APN 4 43532861 missense possibly damaging 0.89
IGL03183:Tln1 APN 4 43539084 splice site probably benign
H8786:Tln1 UTSW 4 43544589 missense probably damaging 0.97
PIT4576001:Tln1 UTSW 4 43539998 missense probably damaging 1.00
PIT4696001:Tln1 UTSW 4 43542701 critical splice donor site probably null
R0206:Tln1 UTSW 4 43549151 missense probably damaging 1.00
R0208:Tln1 UTSW 4 43549151 missense probably damaging 1.00
R0454:Tln1 UTSW 4 43553504 missense probably benign
R0539:Tln1 UTSW 4 43543434 critical splice donor site probably null
R0548:Tln1 UTSW 4 43542709 missense possibly damaging 0.79
R0561:Tln1 UTSW 4 43550304 missense possibly damaging 0.94
R0606:Tln1 UTSW 4 43547756 missense probably benign 0.34
R0607:Tln1 UTSW 4 43553071 missense probably damaging 1.00
R0609:Tln1 UTSW 4 43544645 missense possibly damaging 0.63
R0847:Tln1 UTSW 4 43555333 missense probably damaging 1.00
R0993:Tln1 UTSW 4 43549825 missense probably benign 0.22
R1255:Tln1 UTSW 4 43538044 missense probably damaging 1.00
R1292:Tln1 UTSW 4 43534578 critical splice donor site probably null
R1752:Tln1 UTSW 4 43536311 missense probably damaging 1.00
R2169:Tln1 UTSW 4 43548005 missense probably damaging 1.00
R2172:Tln1 UTSW 4 43545721 missense probably benign
R2202:Tln1 UTSW 4 43553083 splice site probably null
R2680:Tln1 UTSW 4 43539668 missense probably damaging 1.00
R3012:Tln1 UTSW 4 43542525 missense probably benign
R3714:Tln1 UTSW 4 43540597 missense probably damaging 1.00
R3735:Tln1 UTSW 4 43549370 missense probably damaging 0.97
R3794:Tln1 UTSW 4 43536295 missense probably damaging 1.00
R3825:Tln1 UTSW 4 43536413 splice site probably benign
R3983:Tln1 UTSW 4 43553030 missense probably damaging 1.00
R4061:Tln1 UTSW 4 43549177 missense probably damaging 1.00
R4249:Tln1 UTSW 4 43536104 missense probably damaging 1.00
R4287:Tln1 UTSW 4 43543509 missense probably benign 0.01
R4471:Tln1 UTSW 4 43551018 missense probably benign 0.03
R4562:Tln1 UTSW 4 43533598 missense probably damaging 1.00
R4654:Tln1 UTSW 4 43535954 missense probably null 1.00
R4737:Tln1 UTSW 4 43540588 missense probably benign 0.00
R4936:Tln1 UTSW 4 43547522 missense possibly damaging 0.83
R5225:Tln1 UTSW 4 43539406 missense probably benign 0.06
R5288:Tln1 UTSW 4 43540661 missense probably benign 0.06
R5421:Tln1 UTSW 4 43533609 missense possibly damaging 0.80
R5445:Tln1 UTSW 4 43543905 missense probably benign 0.26
R5660:Tln1 UTSW 4 43547732 missense probably damaging 1.00
R5772:Tln1 UTSW 4 43545191 missense probably benign 0.13
R6012:Tln1 UTSW 4 43539508 missense probably benign
R6038:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6038:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6039:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6039:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6052:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6145:Tln1 UTSW 4 43538030 missense possibly damaging 0.64
R6157:Tln1 UTSW 4 43534744 missense probably benign 0.06
R6242:Tln1 UTSW 4 43533145 missense probably damaging 1.00
R6454:Tln1 UTSW 4 43533866 missense probably damaging 0.99
R6467:Tln1 UTSW 4 43543165 missense probably benign 0.42
R6548:Tln1 UTSW 4 43547525 missense probably damaging 0.98
R6576:Tln1 UTSW 4 43555419 splice site probably null
R6722:Tln1 UTSW 4 43547618 missense probably damaging 1.00
R6968:Tln1 UTSW 4 43550217 missense probably benign 0.02
R7000:Tln1 UTSW 4 43556302 missense probably damaging 0.96
R7137:Tln1 UTSW 4 43540616 missense probably damaging 1.00
R7242:Tln1 UTSW 4 43542602 missense probably benign 0.01
R7294:Tln1 UTSW 4 43534399 missense probably benign 0.02
R7312:Tln1 UTSW 4 43545922 missense probably damaging 1.00
R7547:Tln1 UTSW 4 43545206 missense possibly damaging 0.80
R7836:Tln1 UTSW 4 43554309 missense probably benign 0.01
R7874:Tln1 UTSW 4 43538041 missense probably damaging 1.00
R7874:Tln1 UTSW 4 43555606 missense probably damaging 1.00
R8030:Tln1 UTSW 4 43535737 critical splice donor site probably null
R8105:Tln1 UTSW 4 43538231 missense probably benign 0.32
R8212:Tln1 UTSW 4 43555918 missense probably damaging 1.00
R8416:Tln1 UTSW 4 43540116 missense probably benign 0.01
R8419:Tln1 UTSW 4 43536397 missense probably damaging 1.00
R8680:Tln1 UTSW 4 43553041 missense possibly damaging 0.52
R8708:Tln1 UTSW 4 43534769 splice site probably benign
R8727:Tln1 UTSW 4 43555911 missense possibly damaging 0.94
R8830:Tln1 UTSW 4 43556383 missense probably benign
R8865:Tln1 UTSW 4 43538281 missense possibly damaging 0.93
R9049:Tln1 UTSW 4 43549786 nonsense probably null
R9050:Tln1 UTSW 4 43549786 nonsense probably null
R9145:Tln1 UTSW 4 43536024 missense probably damaging 1.00
R9210:Tln1 UTSW 4 43536119 missense probably damaging 1.00
R9337:Tln1 UTSW 4 43532927 missense probably damaging 1.00
R9346:Tln1 UTSW 4 43546895 missense probably damaging 0.97
R9358:Tln1 UTSW 4 43532084 missense possibly damaging 0.68
R9487:Tln1 UTSW 4 43542893 missense probably damaging 1.00
R9631:Tln1 UTSW 4 43545694 missense probably damaging 1.00
R9650:Tln1 UTSW 4 43545912 missense probably damaging 1.00
R9666:Tln1 UTSW 4 43542957 missense probably damaging 0.96
RF021:Tln1 UTSW 4 43555890 missense probably damaging 1.00
X0052:Tln1 UTSW 4 43533125 critical splice donor site probably null
X0063:Tln1 UTSW 4 43548015 nonsense probably null
Z1176:Tln1 UTSW 4 43543211 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TCTCGAACCAGTGAATACTCATC -3'
(R):5'- GTTTTCTGACACAGGCAGCC -3'

Sequencing Primer
(F):5'- CCAGTGAATACTCATCATGGTTGG -3'
(R):5'- CCTCCTTCTAGATGAACCACCCTAG -3'
Posted On 2021-03-08