Incidental Mutation 'R8725:Eif2b3'
ID 662338
Institutional Source Beutler Lab
Gene Symbol Eif2b3
Ensembl Gene ENSMUSG00000028683
Gene Name eukaryotic translation initiation factor 2B, subunit 3
Synonyms 1190002P15Rik
MMRRC Submission 068574-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8725 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 116876559-116944049 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 116927944 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 388 (T388A)
Ref Sequence ENSEMBL: ENSMUSP00000102055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070610] [ENSMUST00000106447] [ENSMUST00000106448]
AlphaFold B1AUN2
Predicted Effect probably benign
Transcript: ENSMUST00000070610
AA Change: T388A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000070334
Gene: ENSMUSG00000028683
AA Change: T388A

DomainStartEndE-ValueType
Pfam:NTP_transferase 4 139 8.2e-20 PFAM
Pfam:NTP_transf_3 5 226 8.5e-19 PFAM
low complexity region 247 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106447
AA Change: T388A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000102055
Gene: ENSMUSG00000028683
AA Change: T388A

DomainStartEndE-ValueType
Pfam:NTP_transferase 4 139 1.1e-19 PFAM
Pfam:NTP_transf_3 5 221 1.7e-18 PFAM
low complexity region 247 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106448
AA Change: T388A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102056
Gene: ENSMUSG00000028683
AA Change: T388A

DomainStartEndE-ValueType
Pfam:NTP_transferase 4 140 3.2e-19 PFAM
Pfam:NTP_transf_3 5 237 3.7e-18 PFAM
low complexity region 247 262 N/A INTRINSIC
Meta Mutation Damage Score 0.0907 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the subunits of initiation factor eIF2B, which catalyzes the exchange of eukaryotic initiation factor 2-bound GDP for GTP. It has also been found to function as a cofactor of hepatitis C virus internal ribosome entry site-mediated translation. Mutations in this gene have been associated with leukodystrophy with vanishing white matter. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630089N07Rik C T 16: 97,867,651 (GRCm39) A104T probably damaging Het
Abhd18 T A 3: 40,884,627 (GRCm39) L222Q probably damaging Het
Adam30 C T 3: 98,070,348 (GRCm39) T727M possibly damaging Het
Adh6b A T 3: 138,058,729 (GRCm39) Q137L probably damaging Het
Alpl C T 4: 137,475,127 (GRCm39) V269I probably benign Het
Ang2 C T 14: 51,432,996 (GRCm39) G129S probably benign Het
Atp6v0a1 A T 11: 100,920,015 (GRCm39) H216L possibly damaging Het
BC030500 C T 8: 59,366,049 (GRCm39) T61I unknown Het
Brpf1 T G 6: 113,293,491 (GRCm39) L520R probably damaging Het
Btbd10 A G 7: 112,927,626 (GRCm39) I243T possibly damaging Het
Bub1 C A 2: 127,646,139 (GRCm39) C947F probably damaging Het
C4b T C 17: 34,953,459 (GRCm39) E1008G probably damaging Het
Ccdc40 A G 11: 119,155,323 (GRCm39) T1188A probably benign Het
Cdcp3 A G 7: 130,875,485 (GRCm39) T1770A unknown Het
Cnn1 G T 9: 22,010,557 (GRCm39) probably benign Het
Colgalt2 T C 1: 152,360,662 (GRCm39) M233T probably damaging Het
Cox15 A T 19: 43,735,181 (GRCm39) C195* probably null Het
Cped1 A T 6: 22,059,941 (GRCm39) R202S possibly damaging Het
Dact2 A T 17: 14,417,146 (GRCm39) C351* probably null Het
Dbnl A G 11: 5,738,582 (GRCm39) N8S probably benign Het
Depdc1a T A 3: 159,228,356 (GRCm39) N369K probably benign Het
Dnah2 A T 11: 69,415,005 (GRCm39) L243Q probably damaging Het
Dscaml1 T A 9: 45,341,759 (GRCm39) Y57N probably benign Het
Eif4h A C 5: 134,654,393 (GRCm39) probably null Het
Elf1 C T 14: 79,810,667 (GRCm39) Q288* probably null Het
Fgl2 C T 5: 21,580,677 (GRCm39) R340* probably null Het
Fut4 T C 9: 14,662,082 (GRCm39) D404G probably damaging Het
Glmn G A 5: 107,718,152 (GRCm39) P255L probably benign Het
Gm14322 C T 2: 177,411,481 (GRCm39) T97I probably benign Het
Gm44511 C A 6: 128,797,997 (GRCm39) C32F probably damaging Het
Gm5478 A G 15: 101,553,871 (GRCm39) F247S probably damaging Het
Golgb1 T A 16: 36,739,563 (GRCm39) M2675K probably damaging Het
Hectd1 T C 12: 51,849,000 (GRCm39) D368G possibly damaging Het
Hnrnpul2 A G 19: 8,798,064 (GRCm39) N140S probably benign Het
Htr4 A T 18: 62,561,209 (GRCm39) I157L probably damaging Het
Kcnma1 T G 14: 23,436,332 (GRCm39) M790L probably benign Het
Kcnv1 G A 15: 44,977,999 (GRCm39) S13L unknown Het
Kctd20 C T 17: 29,184,025 (GRCm39) R312* probably null Het
Kdm3b T A 18: 34,960,435 (GRCm39) I1340N probably damaging Het
Kdm6b A G 11: 69,292,919 (GRCm39) F1286L unknown Het
Knl1 T A 2: 118,899,524 (GRCm39) F408L probably benign Het
Lypd5 G T 7: 24,053,101 (GRCm39) G253W probably damaging Het
Mea1 A G 17: 46,992,614 (GRCm39) T21A probably benign Het
Metrnl A G 11: 121,606,842 (GRCm39) E299G possibly damaging Het
Muc5ac C T 7: 141,363,481 (GRCm39) probably benign Het
Nbn G A 4: 15,963,911 (GRCm39) S104N probably damaging Het
Nxpe2 A T 9: 48,238,073 (GRCm39) F61I probably benign Het
Or6c1b T C 10: 129,273,334 (GRCm39) Y218H probably benign Het
Or6c70 T A 10: 129,710,092 (GRCm39) D178V probably damaging Het
Pgr C A 9: 8,901,544 (GRCm39) P359Q probably damaging Het
Pi4k2b G A 5: 52,908,031 (GRCm39) V157I probably benign Het
Plekhm1 A C 11: 103,258,444 (GRCm39) F1031L probably damaging Het
Pltp A G 2: 164,696,301 (GRCm39) S124P probably damaging Het
Polr3gl T A 3: 96,487,154 (GRCm39) E177V probably benign Het
Pstk G T 7: 130,973,024 (GRCm39) R41L possibly damaging Het
Rasgrp1 T C 2: 117,119,158 (GRCm39) E493G probably benign Het
Rtn3 A G 19: 7,434,726 (GRCm39) L422P probably benign Het
Rusc2 C T 4: 43,401,351 (GRCm39) probably benign Het
Sbno2 A G 10: 79,911,090 (GRCm39) F6S probably benign Het
Sh2d4a A G 8: 68,798,695 (GRCm39) Y348C probably damaging Het
Sh3rf3 A G 10: 58,939,992 (GRCm39) probably null Het
Sipa1l2 T C 8: 126,177,125 (GRCm39) E1163G probably benign Het
Strip1 G C 3: 107,521,964 (GRCm39) A738G probably damaging Het
Tdrkh C T 3: 94,333,299 (GRCm39) R255C probably benign Het
Tln1 A T 4: 43,555,911 (GRCm39) M101K possibly damaging Het
Trav6-2 A C 14: 52,905,028 (GRCm39) probably benign Het
Tspan11 A T 6: 127,900,674 (GRCm39) I82F possibly damaging Het
Ttn T C 2: 76,779,320 (GRCm39) K1233E unknown Het
Usp29 A T 7: 6,965,917 (GRCm39) S587C probably damaging Het
Vmn1r235 A T 17: 21,482,056 (GRCm39) Q127L probably damaging Het
Vmn1r65 C A 7: 6,011,503 (GRCm39) A244S probably damaging Het
Vmn2r18 A G 5: 151,508,462 (GRCm39) S221P probably damaging Het
Zfp229 T C 17: 21,964,828 (GRCm39) S353P probably damaging Het
Zpld2 T C 4: 133,930,150 (GRCm39) K52E probably benign Het
Other mutations in Eif2b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Eif2b3 APN 4 116,923,666 (GRCm39) missense probably benign
IGL01333:Eif2b3 APN 4 116,927,887 (GRCm39) missense probably benign 0.31
IGL01564:Eif2b3 APN 4 116,885,739 (GRCm39) missense probably benign 0.00
IGL01721:Eif2b3 APN 4 116,916,001 (GRCm39) missense probably damaging 1.00
IGL02061:Eif2b3 APN 4 116,885,608 (GRCm39) missense possibly damaging 0.78
Cambio UTSW 4 116,923,578 (GRCm39) nonsense probably null
mogrify UTSW 4 116,885,622 (GRCm39) missense possibly damaging 0.66
R0835:Eif2b3 UTSW 4 116,916,002 (GRCm39) missense probably damaging 1.00
R0924:Eif2b3 UTSW 4 116,938,775 (GRCm39) missense possibly damaging 0.93
R2167:Eif2b3 UTSW 4 116,885,737 (GRCm39) missense probably damaging 1.00
R2424:Eif2b3 UTSW 4 116,928,045 (GRCm39) missense probably benign 0.01
R3902:Eif2b3 UTSW 4 116,879,404 (GRCm39) missense probably damaging 1.00
R4105:Eif2b3 UTSW 4 116,938,831 (GRCm39) missense probably damaging 1.00
R4688:Eif2b3 UTSW 4 116,916,046 (GRCm39) missense probably benign 0.03
R4998:Eif2b3 UTSW 4 116,923,589 (GRCm39) missense probably benign 0.06
R5033:Eif2b3 UTSW 4 116,909,933 (GRCm39) missense probably damaging 1.00
R5123:Eif2b3 UTSW 4 116,879,408 (GRCm39) missense probably damaging 1.00
R5493:Eif2b3 UTSW 4 116,943,919 (GRCm39) missense possibly damaging 0.92
R5787:Eif2b3 UTSW 4 116,901,637 (GRCm39) missense probably damaging 1.00
R5789:Eif2b3 UTSW 4 116,885,692 (GRCm39) missense probably damaging 1.00
R6347:Eif2b3 UTSW 4 116,901,763 (GRCm39) missense probably benign 0.05
R6361:Eif2b3 UTSW 4 116,885,622 (GRCm39) missense possibly damaging 0.66
R6643:Eif2b3 UTSW 4 116,927,954 (GRCm39) missense probably damaging 0.97
R6798:Eif2b3 UTSW 4 116,923,655 (GRCm39) missense probably benign 0.00
R7299:Eif2b3 UTSW 4 116,910,019 (GRCm39) missense probably benign 0.27
R7301:Eif2b3 UTSW 4 116,910,019 (GRCm39) missense probably benign 0.27
R7451:Eif2b3 UTSW 4 116,909,993 (GRCm39) nonsense probably null
R7934:Eif2b3 UTSW 4 116,923,675 (GRCm39) missense probably benign
R8117:Eif2b3 UTSW 4 116,879,414 (GRCm39) missense probably damaging 0.98
R8727:Eif2b3 UTSW 4 116,927,944 (GRCm39) missense probably benign 0.01
R8816:Eif2b3 UTSW 4 116,928,052 (GRCm39) missense probably benign
R8943:Eif2b3 UTSW 4 116,901,778 (GRCm39) missense probably damaging 0.99
R9141:Eif2b3 UTSW 4 116,923,578 (GRCm39) nonsense probably null
R9426:Eif2b3 UTSW 4 116,923,578 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TACCAGCTCAAAGAATGGGG -3'
(R):5'- GCAGTTTCTCACAGGAGCAC -3'

Sequencing Primer
(F):5'- CAGCTCAAAGAATGGGGGTTGATTTC -3'
(R):5'- AGTGATATTCTGAGTTCATGTCACTG -3'
Posted On 2021-03-08