Incidental Mutation 'R8725:Lypd5'
ID662352
Institutional Source Beutler Lab
Gene Symbol Lypd5
Ensembl Gene ENSMUSG00000030484
Gene NameLy6/Plaur domain containing 5
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8725 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location24349196-24355109 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 24353676 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 253 (G253W)
Ref Sequence ENSEMBL: ENSMUSP00000032683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032683]
Predicted Effect probably damaging
Transcript: ENSMUST00000032683
AA Change: G253W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032683
Gene: ENSMUSG00000030484
AA Change: G253W

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Blast:LU 24 119 7e-38 BLAST
LU 132 225 1.19e-1 SMART
low complexity region 230 248 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A G 7: 131,273,756 T1770A unknown Het
A630089N07Rik C T 16: 98,066,451 A104T probably damaging Het
Abhd18 T A 3: 40,930,192 L222Q probably damaging Het
Adam30 C T 3: 98,163,032 T727M possibly damaging Het
Adh6b A T 3: 138,352,968 Q137L probably damaging Het
Alpl C T 4: 137,747,816 V269I probably benign Het
Ang2 C T 14: 51,195,539 G129S probably benign Het
Atp6v0a1 A T 11: 101,029,189 H216L possibly damaging Het
BC030500 C T 8: 58,913,015 T61I unknown Het
Brpf1 T G 6: 113,316,530 L520R probably damaging Het
Btbd10 A G 7: 113,328,419 I243T possibly damaging Het
Bub1 C A 2: 127,804,219 C947F probably damaging Het
C4b T C 17: 34,734,485 E1008G probably damaging Het
Ccdc40 A G 11: 119,264,497 T1188A probably benign Het
Cnn1 G T 9: 22,099,261 probably benign Het
Colgalt2 T C 1: 152,484,911 M233T probably damaging Het
Cox15 A T 19: 43,746,742 C195* probably null Het
Cped1 A T 6: 22,059,942 R202S possibly damaging Het
Dact2 A T 17: 14,196,884 C351* probably null Het
Dbnl A G 11: 5,788,582 N8S probably benign Het
Depdc1a T A 3: 159,522,719 N369K probably benign Het
Dnah2 A T 11: 69,524,179 L243Q probably damaging Het
Dscaml1 T A 9: 45,430,461 Y57N probably benign Het
Eif2b3 A G 4: 117,070,747 T388A probably benign Het
Eif4h A C 5: 134,625,539 probably null Het
Elf1 C T 14: 79,573,227 Q288* probably null Het
Fgl2 C T 5: 21,375,679 R340* probably null Het
Fut4 T C 9: 14,750,786 D404G probably damaging Het
Glmn G A 5: 107,570,286 P255L probably benign Het
Gm14322 C T 2: 177,769,688 T97I probably benign Het
Gm44511 C A 6: 128,821,034 C32F probably damaging Het
Gm5478 A G 15: 101,645,436 F247S probably damaging Het
Gm7534 T C 4: 134,202,839 K52E probably benign Het
Golgb1 T A 16: 36,919,201 M2675K probably damaging Het
Hectd1 T C 12: 51,802,217 D368G possibly damaging Het
Hnrnpul2 A G 19: 8,820,700 N140S probably benign Het
Htr4 A T 18: 62,428,138 I157L probably damaging Het
Kcnma1 T G 14: 23,386,264 M790L probably benign Het
Kcnv1 G A 15: 45,114,603 S13L unknown Het
Kctd20 C T 17: 28,965,051 R312* probably null Het
Kdm3b T A 18: 34,827,382 I1340N probably damaging Het
Kdm6b A G 11: 69,402,093 F1286L unknown Het
Knl1 T A 2: 119,069,043 F408L probably benign Het
Mea1 A G 17: 46,681,688 T21A probably benign Het
Metrnl A G 11: 121,716,016 E299G possibly damaging Het
Muc5ac C T 7: 141,809,744 probably benign Het
Nbn G A 4: 15,963,911 S104N probably damaging Het
Nxpe2 A T 9: 48,326,773 F61I probably benign Het
Olfr786 T C 10: 129,437,465 Y218H probably benign Het
Olfr814 T A 10: 129,874,223 D178V probably damaging Het
Pgr C A 9: 8,901,543 P359Q probably damaging Het
Pi4k2b G A 5: 52,750,689 V157I probably benign Het
Plekhm1 A C 11: 103,367,618 F1031L probably damaging Het
Pltp A G 2: 164,854,381 S124P probably damaging Het
Polr3gl T A 3: 96,579,838 E177V probably benign Het
Pstk G T 7: 131,371,295 R41L possibly damaging Het
Rasgrp1 T C 2: 117,288,677 E493G probably benign Het
Rtn3 A G 19: 7,457,361 L422P probably benign Het
Rusc2 C T 4: 43,401,351 probably benign Het
Sbno2 A G 10: 80,075,256 F6S probably benign Het
Sh2d4a A G 8: 68,346,043 Y348C probably damaging Het
Sh3rf3 A G 10: 59,104,170 probably null Het
Sipa1l2 T C 8: 125,450,386 E1163G probably benign Het
Strip1 G C 3: 107,614,648 A738G probably damaging Het
Tdrkh C T 3: 94,425,992 R255C probably benign Het
Tln1 A T 4: 43,555,911 M101K possibly damaging Het
Trav6-2 A C 14: 52,667,571 probably benign Het
Tspan11 A T 6: 127,923,711 I82F possibly damaging Het
Ttn T C 2: 76,948,976 K1233E unknown Het
Usp29 A T 7: 6,962,918 S587C probably damaging Het
Vmn1r235 A T 17: 21,261,794 Q127L probably damaging Het
Vmn1r65 C A 7: 6,008,504 A244S probably damaging Het
Vmn2r18 A G 5: 151,584,997 S221P probably damaging Het
Zfp229 T C 17: 21,745,847 S353P probably damaging Het
Other mutations in Lypd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Lypd5 APN 7 24353485 missense probably benign 0.10
IGL01121:Lypd5 APN 7 24351551 missense probably benign
IGL01689:Lypd5 APN 7 24352629 splice site probably benign
IGL02584:Lypd5 APN 7 24353568 missense possibly damaging 0.59
IGL02888:Lypd5 APN 7 24352619 missense probably damaging 0.98
R5167:Lypd5 UTSW 7 24352464 missense possibly damaging 0.79
R5982:Lypd5 UTSW 7 24353037 missense probably damaging 1.00
R6746:Lypd5 UTSW 7 24353106 splice site probably null
R7951:Lypd5 UTSW 7 24351635 missense probably damaging 0.96
R8704:Lypd5 UTSW 7 24351557 missense possibly damaging 0.62
R8727:Lypd5 UTSW 7 24353676 missense probably damaging 1.00
X0057:Lypd5 UTSW 7 24349221 utr 5 prime probably benign
Z1177:Lypd5 UTSW 7 24352613 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTGAAATGTGGTAGAGGAC -3'
(R):5'- ACTGGATAGATGGGCCTTCC -3'

Sequencing Primer
(F):5'- GTGTACATCCGGACCTGTCAC -3'
(R):5'- TGGGCCTTCCAGGAGGTG -3'
Posted On2021-03-08