Incidental Mutation 'R8725:Atp6v0a1'
ID 662372
Institutional Source Beutler Lab
Gene Symbol Atp6v0a1
Ensembl Gene ENSMUSG00000019302
Gene Name ATPase, H+ transporting, lysosomal V0 subunit A1
Synonyms V-ATPase a1, Vpp-1, Vpp1, Atp6n1, Atp6n1a
MMRRC Submission 068574-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8725 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 100900278-100954545 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 100920015 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 216 (H216L)
Ref Sequence ENSEMBL: ENSMUSP00000044838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044721] [ENSMUST00000092663] [ENSMUST00000103110] [ENSMUST00000168757]
AlphaFold Q9Z1G4
Predicted Effect possibly damaging
Transcript: ENSMUST00000044721
AA Change: H216L

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000044838
Gene: ENSMUSG00000019302
AA Change: H216L

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 829 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000092663
AA Change: H216L

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000090333
Gene: ENSMUSG00000019302
AA Change: H216L

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 823 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103110
AA Change: H223L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000099399
Gene: ENSMUSG00000019302
AA Change: H223L

DomainStartEndE-ValueType
Pfam:V_ATPase_I 27 829 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000168757
AA Change: H216L

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000131848
Gene: ENSMUSG00000019302
AA Change: H216L

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 829 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c", and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This gene encodes one of three A subunit proteins and the encoded protein is associated with clathrin-coated vesicles. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630089N07Rik C T 16: 97,867,651 (GRCm39) A104T probably damaging Het
Abhd18 T A 3: 40,884,627 (GRCm39) L222Q probably damaging Het
Adam30 C T 3: 98,070,348 (GRCm39) T727M possibly damaging Het
Adh6b A T 3: 138,058,729 (GRCm39) Q137L probably damaging Het
Alpl C T 4: 137,475,127 (GRCm39) V269I probably benign Het
Ang2 C T 14: 51,432,996 (GRCm39) G129S probably benign Het
BC030500 C T 8: 59,366,049 (GRCm39) T61I unknown Het
Brpf1 T G 6: 113,293,491 (GRCm39) L520R probably damaging Het
Btbd10 A G 7: 112,927,626 (GRCm39) I243T possibly damaging Het
Bub1 C A 2: 127,646,139 (GRCm39) C947F probably damaging Het
C4b T C 17: 34,953,459 (GRCm39) E1008G probably damaging Het
Ccdc40 A G 11: 119,155,323 (GRCm39) T1188A probably benign Het
Cdcp3 A G 7: 130,875,485 (GRCm39) T1770A unknown Het
Cnn1 G T 9: 22,010,557 (GRCm39) probably benign Het
Colgalt2 T C 1: 152,360,662 (GRCm39) M233T probably damaging Het
Cox15 A T 19: 43,735,181 (GRCm39) C195* probably null Het
Cped1 A T 6: 22,059,941 (GRCm39) R202S possibly damaging Het
Dact2 A T 17: 14,417,146 (GRCm39) C351* probably null Het
Dbnl A G 11: 5,738,582 (GRCm39) N8S probably benign Het
Depdc1a T A 3: 159,228,356 (GRCm39) N369K probably benign Het
Dnah2 A T 11: 69,415,005 (GRCm39) L243Q probably damaging Het
Dscaml1 T A 9: 45,341,759 (GRCm39) Y57N probably benign Het
Eif2b3 A G 4: 116,927,944 (GRCm39) T388A probably benign Het
Eif4h A C 5: 134,654,393 (GRCm39) probably null Het
Elf1 C T 14: 79,810,667 (GRCm39) Q288* probably null Het
Fgl2 C T 5: 21,580,677 (GRCm39) R340* probably null Het
Fut4 T C 9: 14,662,082 (GRCm39) D404G probably damaging Het
Glmn G A 5: 107,718,152 (GRCm39) P255L probably benign Het
Gm14322 C T 2: 177,411,481 (GRCm39) T97I probably benign Het
Gm44511 C A 6: 128,797,997 (GRCm39) C32F probably damaging Het
Gm5478 A G 15: 101,553,871 (GRCm39) F247S probably damaging Het
Golgb1 T A 16: 36,739,563 (GRCm39) M2675K probably damaging Het
Hectd1 T C 12: 51,849,000 (GRCm39) D368G possibly damaging Het
Hnrnpul2 A G 19: 8,798,064 (GRCm39) N140S probably benign Het
Htr4 A T 18: 62,561,209 (GRCm39) I157L probably damaging Het
Kcnma1 T G 14: 23,436,332 (GRCm39) M790L probably benign Het
Kcnv1 G A 15: 44,977,999 (GRCm39) S13L unknown Het
Kctd20 C T 17: 29,184,025 (GRCm39) R312* probably null Het
Kdm3b T A 18: 34,960,435 (GRCm39) I1340N probably damaging Het
Kdm6b A G 11: 69,292,919 (GRCm39) F1286L unknown Het
Knl1 T A 2: 118,899,524 (GRCm39) F408L probably benign Het
Lypd5 G T 7: 24,053,101 (GRCm39) G253W probably damaging Het
Mea1 A G 17: 46,992,614 (GRCm39) T21A probably benign Het
Metrnl A G 11: 121,606,842 (GRCm39) E299G possibly damaging Het
Muc5ac C T 7: 141,363,481 (GRCm39) probably benign Het
Nbn G A 4: 15,963,911 (GRCm39) S104N probably damaging Het
Nxpe2 A T 9: 48,238,073 (GRCm39) F61I probably benign Het
Or6c1b T C 10: 129,273,334 (GRCm39) Y218H probably benign Het
Or6c70 T A 10: 129,710,092 (GRCm39) D178V probably damaging Het
Pgr C A 9: 8,901,544 (GRCm39) P359Q probably damaging Het
Pi4k2b G A 5: 52,908,031 (GRCm39) V157I probably benign Het
Plekhm1 A C 11: 103,258,444 (GRCm39) F1031L probably damaging Het
Pltp A G 2: 164,696,301 (GRCm39) S124P probably damaging Het
Polr3gl T A 3: 96,487,154 (GRCm39) E177V probably benign Het
Pstk G T 7: 130,973,024 (GRCm39) R41L possibly damaging Het
Rasgrp1 T C 2: 117,119,158 (GRCm39) E493G probably benign Het
Rtn3 A G 19: 7,434,726 (GRCm39) L422P probably benign Het
Rusc2 C T 4: 43,401,351 (GRCm39) probably benign Het
Sbno2 A G 10: 79,911,090 (GRCm39) F6S probably benign Het
Sh2d4a A G 8: 68,798,695 (GRCm39) Y348C probably damaging Het
Sh3rf3 A G 10: 58,939,992 (GRCm39) probably null Het
Sipa1l2 T C 8: 126,177,125 (GRCm39) E1163G probably benign Het
Strip1 G C 3: 107,521,964 (GRCm39) A738G probably damaging Het
Tdrkh C T 3: 94,333,299 (GRCm39) R255C probably benign Het
Tln1 A T 4: 43,555,911 (GRCm39) M101K possibly damaging Het
Trav6-2 A C 14: 52,905,028 (GRCm39) probably benign Het
Tspan11 A T 6: 127,900,674 (GRCm39) I82F possibly damaging Het
Ttn T C 2: 76,779,320 (GRCm39) K1233E unknown Het
Usp29 A T 7: 6,965,917 (GRCm39) S587C probably damaging Het
Vmn1r235 A T 17: 21,482,056 (GRCm39) Q127L probably damaging Het
Vmn1r65 C A 7: 6,011,503 (GRCm39) A244S probably damaging Het
Vmn2r18 A G 5: 151,508,462 (GRCm39) S221P probably damaging Het
Zfp229 T C 17: 21,964,828 (GRCm39) S353P probably damaging Het
Zpld2 T C 4: 133,930,150 (GRCm39) K52E probably benign Het
Other mutations in Atp6v0a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00687:Atp6v0a1 APN 11 100,921,331 (GRCm39) critical splice donor site probably null
IGL01024:Atp6v0a1 APN 11 100,939,265 (GRCm39) missense probably benign 0.00
IGL01390:Atp6v0a1 APN 11 100,934,628 (GRCm39) missense probably benign 0.01
IGL02214:Atp6v0a1 APN 11 100,930,666 (GRCm39) missense probably benign 0.01
IGL02639:Atp6v0a1 APN 11 100,946,344 (GRCm39) missense possibly damaging 0.90
R0125:Atp6v0a1 UTSW 11 100,929,677 (GRCm39) splice site probably null
R0193:Atp6v0a1 UTSW 11 100,939,308 (GRCm39) missense possibly damaging 0.90
R0265:Atp6v0a1 UTSW 11 100,939,341 (GRCm39) missense possibly damaging 0.80
R0973:Atp6v0a1 UTSW 11 100,946,317 (GRCm39) nonsense probably null
R0973:Atp6v0a1 UTSW 11 100,946,317 (GRCm39) nonsense probably null
R0974:Atp6v0a1 UTSW 11 100,946,317 (GRCm39) nonsense probably null
R1460:Atp6v0a1 UTSW 11 100,924,824 (GRCm39) missense probably damaging 1.00
R1580:Atp6v0a1 UTSW 11 100,920,030 (GRCm39) missense probably damaging 1.00
R1625:Atp6v0a1 UTSW 11 100,946,380 (GRCm39) missense probably damaging 1.00
R1644:Atp6v0a1 UTSW 11 100,929,612 (GRCm39) missense possibly damaging 0.65
R1779:Atp6v0a1 UTSW 11 100,917,511 (GRCm39) missense probably benign 0.01
R2895:Atp6v0a1 UTSW 11 100,935,424 (GRCm39) missense probably benign
R2926:Atp6v0a1 UTSW 11 100,934,774 (GRCm39) missense probably damaging 0.99
R3727:Atp6v0a1 UTSW 11 100,921,246 (GRCm39) missense probably benign 0.01
R3943:Atp6v0a1 UTSW 11 100,946,343 (GRCm39) missense probably benign 0.00
R4820:Atp6v0a1 UTSW 11 100,933,776 (GRCm39) missense probably benign 0.00
R5119:Atp6v0a1 UTSW 11 100,911,341 (GRCm39) missense probably benign 0.02
R5250:Atp6v0a1 UTSW 11 100,933,870 (GRCm39) missense possibly damaging 0.94
R5377:Atp6v0a1 UTSW 11 100,946,413 (GRCm39) missense probably damaging 1.00
R5393:Atp6v0a1 UTSW 11 100,929,633 (GRCm39) missense possibly damaging 0.95
R5497:Atp6v0a1 UTSW 11 100,920,011 (GRCm39) missense probably damaging 1.00
R5787:Atp6v0a1 UTSW 11 100,909,400 (GRCm39) missense probably benign 0.04
R6054:Atp6v0a1 UTSW 11 100,930,715 (GRCm39) missense possibly damaging 0.91
R6076:Atp6v0a1 UTSW 11 100,945,886 (GRCm39) missense probably damaging 1.00
R6889:Atp6v0a1 UTSW 11 100,920,009 (GRCm39) missense possibly damaging 0.87
R7035:Atp6v0a1 UTSW 11 100,918,183 (GRCm39) missense probably damaging 0.97
R7084:Atp6v0a1 UTSW 11 100,924,868 (GRCm39) missense probably damaging 1.00
R7212:Atp6v0a1 UTSW 11 100,934,783 (GRCm39) missense probably benign 0.08
R8289:Atp6v0a1 UTSW 11 100,924,931 (GRCm39) missense probably damaging 1.00
R8461:Atp6v0a1 UTSW 11 100,935,400 (GRCm39) missense possibly damaging 0.60
R8680:Atp6v0a1 UTSW 11 100,953,229 (GRCm39) makesense probably null
R8727:Atp6v0a1 UTSW 11 100,920,015 (GRCm39) missense possibly damaging 0.94
R8935:Atp6v0a1 UTSW 11 100,929,519 (GRCm39) missense possibly damaging 0.90
R9658:Atp6v0a1 UTSW 11 100,909,414 (GRCm39) missense probably benign 0.18
R9762:Atp6v0a1 UTSW 11 100,946,427 (GRCm39) missense possibly damaging 0.46
R9779:Atp6v0a1 UTSW 11 100,924,938 (GRCm39) missense probably damaging 1.00
X0023:Atp6v0a1 UTSW 11 100,935,423 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCTGATGCCACCCAAGTTTAATTG -3'
(R):5'- TTCCCAGTGAAAGCAGAACTG -3'

Sequencing Primer
(F):5'- CTTTAAAGCTAGGCCTGTAAGC -3'
(R):5'- AACTGAGGGATCTGCAGGCC -3'
Posted On 2021-03-08