Incidental Mutation 'R8725:Ccdc40'
ID 662374
Institutional Source Beutler Lab
Gene Symbol Ccdc40
Ensembl Gene ENSMUSG00000039963
Gene Name coiled-coil domain containing 40
Synonyms B930008I02Rik
MMRRC Submission 068574-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.174) question?
Stock # R8725 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 119119398-119156064 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 119155323 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1188 (T1188A)
Ref Sequence ENSEMBL: ENSMUSP00000039463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026666] [ENSMUST00000035935] [ENSMUST00000053440] [ENSMUST00000106258] [ENSMUST00000106259]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000026666
SMART Domains Protein: ENSMUSP00000026666
Gene: ENSMUSG00000025579

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PD 80 134 1.08e-15 SMART
Pfam:Gal_mutarotas_2 254 320 3.7e-12 PFAM
Pfam:Glyco_hydro_31 340 825 8.8e-175 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000035935
AA Change: T1188A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000039463
Gene: ENSMUSG00000039963
AA Change: T1188A

DomainStartEndE-ValueType
internal_repeat_1 7 48 1.25e-8 PROSPERO
internal_repeat_1 55 96 1.25e-8 PROSPERO
low complexity region 159 170 N/A INTRINSIC
low complexity region 208 232 N/A INTRINSIC
coiled coil region 349 371 N/A INTRINSIC
coiled coil region 423 447 N/A INTRINSIC
Blast:HisKA 450 519 3e-13 BLAST
Blast:HisKA 574 629 5e-8 BLAST
low complexity region 793 805 N/A INTRINSIC
Pfam:BRE1 830 928 4.2e-20 PFAM
coiled coil region 1044 1112 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000053440
SMART Domains Protein: ENSMUSP00000062198
Gene: ENSMUSG00000039963

DomainStartEndE-ValueType
low complexity region 5 27 N/A INTRINSIC
low complexity region 56 70 N/A INTRINSIC
internal_repeat_1 79 114 5.57e-8 PROSPERO
internal_repeat_1 111 150 5.57e-8 PROSPERO
low complexity region 229 240 N/A INTRINSIC
low complexity region 278 302 N/A INTRINSIC
coiled coil region 419 441 N/A INTRINSIC
coiled coil region 493 517 N/A INTRINSIC
Blast:HisKA 520 589 2e-13 BLAST
Blast:HisKA 644 699 4e-8 BLAST
low complexity region 863 875 N/A INTRINSIC
Pfam:BRE1 900 998 4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106258
SMART Domains Protein: ENSMUSP00000101865
Gene: ENSMUSG00000025579

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PD 80 134 1.08e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106259
SMART Domains Protein: ENSMUSP00000101866
Gene: ENSMUSG00000025579

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PD 80 134 1.08e-15 SMART
Pfam:NtCtMGAM_N 147 253 3.5e-32 PFAM
Pfam:Gal_mutarotas_2 254 320 6.5e-12 PFAM
Pfam:Glyco_hydro_31 340 825 1.8e-153 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is necessary for motile cilia function. It functions in correct left-right axis formation by regulating the assembly of the inner dynein arm and the dynein regulatory complexes, which control ciliary beat. Mutations in this gene cause ciliary dyskinesia type 15, a disorder due to defects in cilia motility. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit heterotaxia, hydrocephalus, short embryonic cilia, and postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630089N07Rik C T 16: 97,867,651 (GRCm39) A104T probably damaging Het
Abhd18 T A 3: 40,884,627 (GRCm39) L222Q probably damaging Het
Adam30 C T 3: 98,070,348 (GRCm39) T727M possibly damaging Het
Adh6b A T 3: 138,058,729 (GRCm39) Q137L probably damaging Het
Alpl C T 4: 137,475,127 (GRCm39) V269I probably benign Het
Ang2 C T 14: 51,432,996 (GRCm39) G129S probably benign Het
Atp6v0a1 A T 11: 100,920,015 (GRCm39) H216L possibly damaging Het
BC030500 C T 8: 59,366,049 (GRCm39) T61I unknown Het
Brpf1 T G 6: 113,293,491 (GRCm39) L520R probably damaging Het
Btbd10 A G 7: 112,927,626 (GRCm39) I243T possibly damaging Het
Bub1 C A 2: 127,646,139 (GRCm39) C947F probably damaging Het
C4b T C 17: 34,953,459 (GRCm39) E1008G probably damaging Het
Cdcp3 A G 7: 130,875,485 (GRCm39) T1770A unknown Het
Cnn1 G T 9: 22,010,557 (GRCm39) probably benign Het
Colgalt2 T C 1: 152,360,662 (GRCm39) M233T probably damaging Het
Cox15 A T 19: 43,735,181 (GRCm39) C195* probably null Het
Cped1 A T 6: 22,059,941 (GRCm39) R202S possibly damaging Het
Dact2 A T 17: 14,417,146 (GRCm39) C351* probably null Het
Dbnl A G 11: 5,738,582 (GRCm39) N8S probably benign Het
Depdc1a T A 3: 159,228,356 (GRCm39) N369K probably benign Het
Dnah2 A T 11: 69,415,005 (GRCm39) L243Q probably damaging Het
Dscaml1 T A 9: 45,341,759 (GRCm39) Y57N probably benign Het
Eif2b3 A G 4: 116,927,944 (GRCm39) T388A probably benign Het
Eif4h A C 5: 134,654,393 (GRCm39) probably null Het
Elf1 C T 14: 79,810,667 (GRCm39) Q288* probably null Het
Fgl2 C T 5: 21,580,677 (GRCm39) R340* probably null Het
Fut4 T C 9: 14,662,082 (GRCm39) D404G probably damaging Het
Glmn G A 5: 107,718,152 (GRCm39) P255L probably benign Het
Gm14322 C T 2: 177,411,481 (GRCm39) T97I probably benign Het
Gm44511 C A 6: 128,797,997 (GRCm39) C32F probably damaging Het
Gm5478 A G 15: 101,553,871 (GRCm39) F247S probably damaging Het
Golgb1 T A 16: 36,739,563 (GRCm39) M2675K probably damaging Het
Hectd1 T C 12: 51,849,000 (GRCm39) D368G possibly damaging Het
Hnrnpul2 A G 19: 8,798,064 (GRCm39) N140S probably benign Het
Htr4 A T 18: 62,561,209 (GRCm39) I157L probably damaging Het
Kcnma1 T G 14: 23,436,332 (GRCm39) M790L probably benign Het
Kcnv1 G A 15: 44,977,999 (GRCm39) S13L unknown Het
Kctd20 C T 17: 29,184,025 (GRCm39) R312* probably null Het
Kdm3b T A 18: 34,960,435 (GRCm39) I1340N probably damaging Het
Kdm6b A G 11: 69,292,919 (GRCm39) F1286L unknown Het
Knl1 T A 2: 118,899,524 (GRCm39) F408L probably benign Het
Lypd5 G T 7: 24,053,101 (GRCm39) G253W probably damaging Het
Mea1 A G 17: 46,992,614 (GRCm39) T21A probably benign Het
Metrnl A G 11: 121,606,842 (GRCm39) E299G possibly damaging Het
Muc5ac C T 7: 141,363,481 (GRCm39) probably benign Het
Nbn G A 4: 15,963,911 (GRCm39) S104N probably damaging Het
Nxpe2 A T 9: 48,238,073 (GRCm39) F61I probably benign Het
Or6c1b T C 10: 129,273,334 (GRCm39) Y218H probably benign Het
Or6c70 T A 10: 129,710,092 (GRCm39) D178V probably damaging Het
Pgr C A 9: 8,901,544 (GRCm39) P359Q probably damaging Het
Pi4k2b G A 5: 52,908,031 (GRCm39) V157I probably benign Het
Plekhm1 A C 11: 103,258,444 (GRCm39) F1031L probably damaging Het
Pltp A G 2: 164,696,301 (GRCm39) S124P probably damaging Het
Polr3gl T A 3: 96,487,154 (GRCm39) E177V probably benign Het
Pstk G T 7: 130,973,024 (GRCm39) R41L possibly damaging Het
Rasgrp1 T C 2: 117,119,158 (GRCm39) E493G probably benign Het
Rtn3 A G 19: 7,434,726 (GRCm39) L422P probably benign Het
Rusc2 C T 4: 43,401,351 (GRCm39) probably benign Het
Sbno2 A G 10: 79,911,090 (GRCm39) F6S probably benign Het
Sh2d4a A G 8: 68,798,695 (GRCm39) Y348C probably damaging Het
Sh3rf3 A G 10: 58,939,992 (GRCm39) probably null Het
Sipa1l2 T C 8: 126,177,125 (GRCm39) E1163G probably benign Het
Strip1 G C 3: 107,521,964 (GRCm39) A738G probably damaging Het
Tdrkh C T 3: 94,333,299 (GRCm39) R255C probably benign Het
Tln1 A T 4: 43,555,911 (GRCm39) M101K possibly damaging Het
Trav6-2 A C 14: 52,905,028 (GRCm39) probably benign Het
Tspan11 A T 6: 127,900,674 (GRCm39) I82F possibly damaging Het
Ttn T C 2: 76,779,320 (GRCm39) K1233E unknown Het
Usp29 A T 7: 6,965,917 (GRCm39) S587C probably damaging Het
Vmn1r235 A T 17: 21,482,056 (GRCm39) Q127L probably damaging Het
Vmn1r65 C A 7: 6,011,503 (GRCm39) A244S probably damaging Het
Vmn2r18 A G 5: 151,508,462 (GRCm39) S221P probably damaging Het
Zfp229 T C 17: 21,964,828 (GRCm39) S353P probably damaging Het
Zpld2 T C 4: 133,930,150 (GRCm39) K52E probably benign Het
Other mutations in Ccdc40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Ccdc40 APN 11 119,133,545 (GRCm39) missense possibly damaging 0.90
IGL01864:Ccdc40 APN 11 119,133,911 (GRCm39) missense probably benign 0.23
IGL01911:Ccdc40 APN 11 119,122,797 (GRCm39) splice site probably null
IGL02640:Ccdc40 APN 11 119,128,904 (GRCm39) missense probably benign 0.18
IGL03278:Ccdc40 APN 11 119,133,336 (GRCm39) missense probably damaging 1.00
IGL03054:Ccdc40 UTSW 11 119,154,027 (GRCm39) missense possibly damaging 0.69
PIT4151001:Ccdc40 UTSW 11 119,133,277 (GRCm39) missense probably damaging 1.00
R0139:Ccdc40 UTSW 11 119,155,125 (GRCm39) missense probably benign 0.00
R0140:Ccdc40 UTSW 11 119,155,125 (GRCm39) missense probably benign 0.00
R0415:Ccdc40 UTSW 11 119,122,944 (GRCm39) missense possibly damaging 0.92
R0617:Ccdc40 UTSW 11 119,133,630 (GRCm39) missense probably damaging 1.00
R1396:Ccdc40 UTSW 11 119,122,629 (GRCm39) missense possibly damaging 0.66
R1531:Ccdc40 UTSW 11 119,154,015 (GRCm39) missense probably benign 0.01
R1751:Ccdc40 UTSW 11 119,121,522 (GRCm39) critical splice donor site probably null
R1767:Ccdc40 UTSW 11 119,121,522 (GRCm39) critical splice donor site probably null
R1870:Ccdc40 UTSW 11 119,150,730 (GRCm39) missense possibly damaging 0.81
R1971:Ccdc40 UTSW 11 119,153,901 (GRCm39) splice site probably null
R2106:Ccdc40 UTSW 11 119,155,123 (GRCm39) missense probably damaging 1.00
R2370:Ccdc40 UTSW 11 119,153,943 (GRCm39) missense probably benign 0.00
R3421:Ccdc40 UTSW 11 119,125,605 (GRCm39) missense probably benign 0.02
R3746:Ccdc40 UTSW 11 119,155,252 (GRCm39) missense probably benign 0.26
R3749:Ccdc40 UTSW 11 119,155,252 (GRCm39) missense probably benign 0.26
R3871:Ccdc40 UTSW 11 119,155,107 (GRCm39) missense probably damaging 1.00
R4508:Ccdc40 UTSW 11 119,133,335 (GRCm39) missense probably damaging 0.98
R4613:Ccdc40 UTSW 11 119,122,358 (GRCm39) missense probably benign 0.09
R4663:Ccdc40 UTSW 11 119,122,332 (GRCm39) missense probably benign 0.01
R4787:Ccdc40 UTSW 11 119,144,447 (GRCm39) missense possibly damaging 0.74
R4867:Ccdc40 UTSW 11 119,122,614 (GRCm39) missense probably benign
R5237:Ccdc40 UTSW 11 119,150,802 (GRCm39) missense probably benign 0.00
R5661:Ccdc40 UTSW 11 119,128,753 (GRCm39) missense probably benign 0.13
R5678:Ccdc40 UTSW 11 119,122,398 (GRCm39) missense possibly damaging 0.61
R5805:Ccdc40 UTSW 11 119,136,906 (GRCm39) critical splice donor site probably null
R5830:Ccdc40 UTSW 11 119,133,572 (GRCm39) missense probably benign 0.00
R5895:Ccdc40 UTSW 11 119,144,229 (GRCm39) missense probably damaging 1.00
R5932:Ccdc40 UTSW 11 119,141,838 (GRCm39) missense probably damaging 0.98
R6034:Ccdc40 UTSW 11 119,133,898 (GRCm39) missense possibly damaging 0.70
R6034:Ccdc40 UTSW 11 119,133,898 (GRCm39) missense possibly damaging 0.70
R6109:Ccdc40 UTSW 11 119,122,804 (GRCm39) missense probably benign
R6166:Ccdc40 UTSW 11 119,122,827 (GRCm39) missense probably benign
R6336:Ccdc40 UTSW 11 119,122,819 (GRCm39) missense possibly damaging 0.82
R6569:Ccdc40 UTSW 11 119,133,560 (GRCm39) missense probably damaging 1.00
R6884:Ccdc40 UTSW 11 119,133,565 (GRCm39) missense possibly damaging 0.82
R7022:Ccdc40 UTSW 11 119,122,612 (GRCm39) missense possibly damaging 0.82
R7212:Ccdc40 UTSW 11 119,155,270 (GRCm39) missense probably damaging 0.99
R7472:Ccdc40 UTSW 11 119,153,974 (GRCm39) missense probably benign 0.30
R7522:Ccdc40 UTSW 11 119,123,047 (GRCm39) missense possibly damaging 0.73
R7888:Ccdc40 UTSW 11 119,119,967 (GRCm39) missense unknown
R8041:Ccdc40 UTSW 11 119,122,507 (GRCm39) missense possibly damaging 0.53
R8117:Ccdc40 UTSW 11 119,144,211 (GRCm39) missense probably benign 0.00
R8162:Ccdc40 UTSW 11 119,150,870 (GRCm39) critical splice donor site probably null
R8514:Ccdc40 UTSW 11 119,121,459 (GRCm39) missense unknown
R8727:Ccdc40 UTSW 11 119,155,323 (GRCm39) missense probably benign
R8799:Ccdc40 UTSW 11 119,155,292 (GRCm39) missense probably benign 0.00
R8877:Ccdc40 UTSW 11 119,153,992 (GRCm39) missense probably damaging 1.00
R9304:Ccdc40 UTSW 11 119,122,597 (GRCm39) missense probably benign 0.06
S24628:Ccdc40 UTSW 11 119,122,944 (GRCm39) missense possibly damaging 0.92
Z1176:Ccdc40 UTSW 11 119,142,834 (GRCm39) missense probably damaging 1.00
Z1177:Ccdc40 UTSW 11 119,145,224 (GRCm39) missense probably benign 0.16
Z1177:Ccdc40 UTSW 11 119,128,933 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AACCTTCTGGAGATCGTGACC -3'
(R):5'- TGAACAGCAGAGAGGCTTTG -3'

Sequencing Primer
(F):5'- AGATCGTGACCCTGCAGAC -3'
(R):5'- CAGAGAGGCTTTGAATCACGTGTC -3'
Posted On 2021-03-08