Incidental Mutation 'R8725:Dact2'
ID 662385
Institutional Source Beutler Lab
Gene Symbol Dact2
Ensembl Gene ENSMUSG00000048826
Gene Name dishevelled-binding antagonist of beta-catenin 2
Synonyms 2900084M21Rik, Frd2, Dpr2, dapper2
MMRRC Submission 068574-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8725 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 14415492-14424595 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 14417146 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 351 (C351*)
Ref Sequence ENSEMBL: ENSMUSP00000051638 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053218]
AlphaFold Q7TN08
Predicted Effect probably null
Transcript: ENSMUST00000053218
AA Change: C351*
SMART Domains Protein: ENSMUSP00000051638
Gene: ENSMUSG00000048826
AA Change: C351*

DomainStartEndE-ValueType
Pfam:Dapper 19 757 1.8e-231 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele develop normally but display enhanced keratinocyte migration and accelerated re-epithelialization during cutaneous wound healing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630089N07Rik C T 16: 97,867,651 (GRCm39) A104T probably damaging Het
Abhd18 T A 3: 40,884,627 (GRCm39) L222Q probably damaging Het
Adam30 C T 3: 98,070,348 (GRCm39) T727M possibly damaging Het
Adh6b A T 3: 138,058,729 (GRCm39) Q137L probably damaging Het
Alpl C T 4: 137,475,127 (GRCm39) V269I probably benign Het
Ang2 C T 14: 51,432,996 (GRCm39) G129S probably benign Het
Atp6v0a1 A T 11: 100,920,015 (GRCm39) H216L possibly damaging Het
BC030500 C T 8: 59,366,049 (GRCm39) T61I unknown Het
Brpf1 T G 6: 113,293,491 (GRCm39) L520R probably damaging Het
Btbd10 A G 7: 112,927,626 (GRCm39) I243T possibly damaging Het
Bub1 C A 2: 127,646,139 (GRCm39) C947F probably damaging Het
C4b T C 17: 34,953,459 (GRCm39) E1008G probably damaging Het
Ccdc40 A G 11: 119,155,323 (GRCm39) T1188A probably benign Het
Cdcp3 A G 7: 130,875,485 (GRCm39) T1770A unknown Het
Cnn1 G T 9: 22,010,557 (GRCm39) probably benign Het
Colgalt2 T C 1: 152,360,662 (GRCm39) M233T probably damaging Het
Cox15 A T 19: 43,735,181 (GRCm39) C195* probably null Het
Cped1 A T 6: 22,059,941 (GRCm39) R202S possibly damaging Het
Dbnl A G 11: 5,738,582 (GRCm39) N8S probably benign Het
Depdc1a T A 3: 159,228,356 (GRCm39) N369K probably benign Het
Dnah2 A T 11: 69,415,005 (GRCm39) L243Q probably damaging Het
Dscaml1 T A 9: 45,341,759 (GRCm39) Y57N probably benign Het
Eif2b3 A G 4: 116,927,944 (GRCm39) T388A probably benign Het
Eif4h A C 5: 134,654,393 (GRCm39) probably null Het
Elf1 C T 14: 79,810,667 (GRCm39) Q288* probably null Het
Fgl2 C T 5: 21,580,677 (GRCm39) R340* probably null Het
Fut4 T C 9: 14,662,082 (GRCm39) D404G probably damaging Het
Glmn G A 5: 107,718,152 (GRCm39) P255L probably benign Het
Gm14322 C T 2: 177,411,481 (GRCm39) T97I probably benign Het
Gm44511 C A 6: 128,797,997 (GRCm39) C32F probably damaging Het
Gm5478 A G 15: 101,553,871 (GRCm39) F247S probably damaging Het
Golgb1 T A 16: 36,739,563 (GRCm39) M2675K probably damaging Het
Hectd1 T C 12: 51,849,000 (GRCm39) D368G possibly damaging Het
Hnrnpul2 A G 19: 8,798,064 (GRCm39) N140S probably benign Het
Htr4 A T 18: 62,561,209 (GRCm39) I157L probably damaging Het
Kcnma1 T G 14: 23,436,332 (GRCm39) M790L probably benign Het
Kcnv1 G A 15: 44,977,999 (GRCm39) S13L unknown Het
Kctd20 C T 17: 29,184,025 (GRCm39) R312* probably null Het
Kdm3b T A 18: 34,960,435 (GRCm39) I1340N probably damaging Het
Kdm6b A G 11: 69,292,919 (GRCm39) F1286L unknown Het
Knl1 T A 2: 118,899,524 (GRCm39) F408L probably benign Het
Lypd5 G T 7: 24,053,101 (GRCm39) G253W probably damaging Het
Mea1 A G 17: 46,992,614 (GRCm39) T21A probably benign Het
Metrnl A G 11: 121,606,842 (GRCm39) E299G possibly damaging Het
Muc5ac C T 7: 141,363,481 (GRCm39) probably benign Het
Nbn G A 4: 15,963,911 (GRCm39) S104N probably damaging Het
Nxpe2 A T 9: 48,238,073 (GRCm39) F61I probably benign Het
Or6c1b T C 10: 129,273,334 (GRCm39) Y218H probably benign Het
Or6c70 T A 10: 129,710,092 (GRCm39) D178V probably damaging Het
Pgr C A 9: 8,901,544 (GRCm39) P359Q probably damaging Het
Pi4k2b G A 5: 52,908,031 (GRCm39) V157I probably benign Het
Plekhm1 A C 11: 103,258,444 (GRCm39) F1031L probably damaging Het
Pltp A G 2: 164,696,301 (GRCm39) S124P probably damaging Het
Polr3gl T A 3: 96,487,154 (GRCm39) E177V probably benign Het
Pstk G T 7: 130,973,024 (GRCm39) R41L possibly damaging Het
Rasgrp1 T C 2: 117,119,158 (GRCm39) E493G probably benign Het
Rtn3 A G 19: 7,434,726 (GRCm39) L422P probably benign Het
Rusc2 C T 4: 43,401,351 (GRCm39) probably benign Het
Sbno2 A G 10: 79,911,090 (GRCm39) F6S probably benign Het
Sh2d4a A G 8: 68,798,695 (GRCm39) Y348C probably damaging Het
Sh3rf3 A G 10: 58,939,992 (GRCm39) probably null Het
Sipa1l2 T C 8: 126,177,125 (GRCm39) E1163G probably benign Het
Strip1 G C 3: 107,521,964 (GRCm39) A738G probably damaging Het
Tdrkh C T 3: 94,333,299 (GRCm39) R255C probably benign Het
Tln1 A T 4: 43,555,911 (GRCm39) M101K possibly damaging Het
Trav6-2 A C 14: 52,905,028 (GRCm39) probably benign Het
Tspan11 A T 6: 127,900,674 (GRCm39) I82F possibly damaging Het
Ttn T C 2: 76,779,320 (GRCm39) K1233E unknown Het
Usp29 A T 7: 6,965,917 (GRCm39) S587C probably damaging Het
Vmn1r235 A T 17: 21,482,056 (GRCm39) Q127L probably damaging Het
Vmn1r65 C A 7: 6,011,503 (GRCm39) A244S probably damaging Het
Vmn2r18 A G 5: 151,508,462 (GRCm39) S221P probably damaging Het
Zfp229 T C 17: 21,964,828 (GRCm39) S353P probably damaging Het
Zpld2 T C 4: 133,930,150 (GRCm39) K52E probably benign Het
Other mutations in Dact2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01867:Dact2 APN 17 14,415,932 (GRCm39) missense probably damaging 0.98
R0597:Dact2 UTSW 17 14,417,303 (GRCm39) missense probably benign
R1657:Dact2 UTSW 17 14,418,252 (GRCm39) missense probably benign 0.03
R1717:Dact2 UTSW 17 14,418,175 (GRCm39) missense probably benign 0.11
R1734:Dact2 UTSW 17 14,416,901 (GRCm39) missense probably benign 0.00
R1883:Dact2 UTSW 17 14,418,085 (GRCm39) missense possibly damaging 0.81
R2238:Dact2 UTSW 17 14,417,312 (GRCm39) missense probably damaging 0.99
R2878:Dact2 UTSW 17 14,416,176 (GRCm39) missense probably damaging 1.00
R4290:Dact2 UTSW 17 14,416,833 (GRCm39) missense probably benign 0.00
R4291:Dact2 UTSW 17 14,416,833 (GRCm39) missense probably benign 0.00
R4902:Dact2 UTSW 17 14,416,991 (GRCm39) missense possibly damaging 0.91
R5029:Dact2 UTSW 17 14,416,114 (GRCm39) missense probably benign 0.00
R5084:Dact2 UTSW 17 14,418,214 (GRCm39) missense possibly damaging 0.94
R5436:Dact2 UTSW 17 14,416,010 (GRCm39) missense probably damaging 1.00
R5837:Dact2 UTSW 17 14,416,515 (GRCm39) missense probably damaging 1.00
R5847:Dact2 UTSW 17 14,419,450 (GRCm39) missense probably damaging 0.97
R6048:Dact2 UTSW 17 14,417,567 (GRCm39) missense probably damaging 1.00
R6377:Dact2 UTSW 17 14,419,450 (GRCm39) missense probably damaging 0.97
R7013:Dact2 UTSW 17 14,423,796 (GRCm39) missense probably benign
R7268:Dact2 UTSW 17 14,416,797 (GRCm39) missense probably benign 0.01
R7425:Dact2 UTSW 17 14,416,593 (GRCm39) missense probably damaging 1.00
R8727:Dact2 UTSW 17 14,417,146 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CATGGACACAGGGATTCCAAGG -3'
(R):5'- GCCCCGTGTTTTGACATCTG -3'

Sequencing Primer
(F):5'- CCAAGGAATGGTTTCTTCCTTTAG -3'
(R):5'- CGTGTTTTGACATCTGCTCAC -3'
Posted On 2021-03-08