Incidental Mutation 'R8726:Rims1'
ID 662397
Institutional Source Beutler Lab
Gene Symbol Rims1
Ensembl Gene ENSMUSG00000041670
Gene Name regulating synaptic membrane exocytosis 1
Synonyms RIM1a, RIM1, RIM1alpha, C030033M19Rik
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.581) question?
Stock # R8726 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 22286251-22805994 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 22594100 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 178 (D178G)
Ref Sequence ENSEMBL: ENSMUSP00000095417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081544] [ENSMUST00000097808] [ENSMUST00000097809] [ENSMUST00000097810] [ENSMUST00000097811] [ENSMUST00000115273] [ENSMUST00000218140]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000081544
SMART Domains Protein: ENSMUSP00000080259
Gene: ENSMUSG00000041670

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
coiled coil region 30 52 N/A INTRINSIC
Pfam:FYVE_2 102 205 2.6e-9 PFAM
low complexity region 283 293 N/A INTRINSIC
low complexity region 329 345 N/A INTRINSIC
low complexity region 381 394 N/A INTRINSIC
PDZ 449 528 1.44e-15 SMART
low complexity region 535 551 N/A INTRINSIC
C2 593 703 7.55e-1 SMART
low complexity region 710 721 N/A INTRINSIC
low complexity region 899 934 N/A INTRINSIC
low complexity region 1011 1025 N/A INTRINSIC
C2 1120 1223 7.45e-15 SMART
low complexity region 1245 1253 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000097808
AA Change: D178G

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000095417
Gene: ENSMUSG00000041670
AA Change: D178G

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
coiled coil region 30 52 N/A INTRINSIC
Pfam:FYVE_2 102 205 3.3e-10 PFAM
low complexity region 283 293 N/A INTRINSIC
low complexity region 329 345 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097809
SMART Domains Protein: ENSMUSP00000095418
Gene: ENSMUSG00000041670

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
coiled coil region 30 52 N/A INTRINSIC
Pfam:FYVE_2 102 205 1e-9 PFAM
low complexity region 283 293 N/A INTRINSIC
low complexity region 329 345 N/A INTRINSIC
low complexity region 381 394 N/A INTRINSIC
PDZ 449 528 1.44e-15 SMART
low complexity region 535 551 N/A INTRINSIC
C2 593 703 7.55e-1 SMART
low complexity region 710 721 N/A INTRINSIC
low complexity region 862 874 N/A INTRINSIC
low complexity region 974 1009 N/A INTRINSIC
low complexity region 1086 1100 N/A INTRINSIC
C2 1195 1298 7.45e-15 SMART
low complexity region 1320 1328 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097810
SMART Domains Protein: ENSMUSP00000095419
Gene: ENSMUSG00000041670

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
coiled coil region 30 52 N/A INTRINSIC
PDB:2CJS|C 131 193 2e-32 PDB
low complexity region 283 293 N/A INTRINSIC
low complexity region 329 345 N/A INTRINSIC
low complexity region 381 394 N/A INTRINSIC
PDZ 449 528 1.44e-15 SMART
low complexity region 535 551 N/A INTRINSIC
C2 593 703 7.55e-1 SMART
low complexity region 710 721 N/A INTRINSIC
low complexity region 862 874 N/A INTRINSIC
low complexity region 916 929 N/A INTRINSIC
low complexity region 1035 1070 N/A INTRINSIC
low complexity region 1147 1161 N/A INTRINSIC
C2 1256 1359 7.45e-15 SMART
low complexity region 1381 1389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097811
SMART Domains Protein: ENSMUSP00000095420
Gene: ENSMUSG00000041670

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
coiled coil region 30 52 N/A INTRINSIC
Pfam:FYVE_2 102 205 1.6e-9 PFAM
low complexity region 283 293 N/A INTRINSIC
low complexity region 329 345 N/A INTRINSIC
low complexity region 381 394 N/A INTRINSIC
PDZ 449 528 1.44e-15 SMART
low complexity region 535 551 N/A INTRINSIC
C2 593 703 7.55e-1 SMART
low complexity region 710 721 N/A INTRINSIC
low complexity region 867 881 N/A INTRINSIC
low complexity region 944 957 N/A INTRINSIC
low complexity region 1063 1098 N/A INTRINSIC
low complexity region 1175 1189 N/A INTRINSIC
C2 1284 1387 7.45e-15 SMART
low complexity region 1409 1417 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115273
SMART Domains Protein: ENSMUSP00000110928
Gene: ENSMUSG00000041670

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
coiled coil region 30 52 N/A INTRINSIC
Pfam:FYVE_2 102 205 2.8e-9 PFAM
low complexity region 283 293 N/A INTRINSIC
low complexity region 329 345 N/A INTRINSIC
low complexity region 381 394 N/A INTRINSIC
PDZ 449 528 1.44e-15 SMART
low complexity region 535 551 N/A INTRINSIC
C2 593 703 7.55e-1 SMART
low complexity region 710 721 N/A INTRINSIC
low complexity region 950 985 N/A INTRINSIC
low complexity region 1062 1076 N/A INTRINSIC
C2 1171 1274 7.45e-15 SMART
low complexity region 1296 1304 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218140
Meta Mutation Damage Score 0.0914 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a RAS gene superfamily member that regulates synaptic vesicle exocytosis. This gene also plays a role in the regulation of voltage-gated calcium channels during neurotransmitter and insulin release. Mutations have suggested a role cognition and have been identified as the cause of cone-rod dystrophy type 7. Multiple transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene display defects in maternal care and abnormalities in synaptic transmission in the central nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik A G 11: 69,898,381 S331P possibly damaging Het
4930433I11Rik A G 7: 40,994,802 M632V probably benign Het
9930111J21Rik2 A C 11: 49,019,680 V642G probably damaging Het
Abcd4 A T 12: 84,604,397 probably benign Het
Acsbg1 T C 9: 54,618,178 E363G probably damaging Het
Ank3 T A 10: 69,987,254 H584Q Het
Ankrd11 A T 8: 122,894,026 L1029Q possibly damaging Het
Anpep C T 7: 79,840,893 V292I probably benign Het
Atmin G A 8: 116,954,786 D175N possibly damaging Het
B4galt6 T C 18: 20,688,393 I359M possibly damaging Het
Bicd2 A G 13: 49,379,429 D497G probably damaging Het
Calcr C T 6: 3,707,489 probably benign Het
Camkk2 G T 5: 122,743,939 D418E probably benign Het
Cntn3 A T 6: 102,169,053 Y942* probably null Het
Col8a1 C T 16: 57,628,775 R124H probably damaging Het
Coro7 T C 16: 4,668,755 T185A possibly damaging Het
Creb3 C T 4: 43,566,747 P364S probably benign Het
Csf1r A T 18: 61,117,656 T480S probably benign Het
Csnk1g1 T A 9: 66,002,271 H223Q probably damaging Het
Ctns C T 11: 73,187,787 V171M probably benign Het
Dhx15 A T 5: 52,154,226 N637K probably benign Het
Eif4g1 T C 16: 20,675,482 Y103H probably damaging Het
Eif4g2 C T 7: 111,077,422 R295H probably damaging Het
Fam126b T C 1: 58,546,126 T171A possibly damaging Het
Fat1 C T 8: 45,024,169 P2084L probably benign Het
Fat4 A G 3: 39,010,498 R4868G probably damaging Het
Fbxo31 A T 8: 121,555,275 Y295* probably null Het
Fmn2 C A 1: 174,609,838 T1125N possibly damaging Het
Foxi2 C A 7: 135,410,404 P7Q probably damaging Het
Hmx1 C T 5: 35,391,756 P131L probably damaging Het
Hrh2 T C 13: 54,214,152 L49P probably damaging Het
Igkv6-14 A G 6: 70,435,141 V53A possibly damaging Het
Kcnb2 C A 1: 15,710,652 Q583K probably benign Het
Kcns3 A G 12: 11,091,691 S336P probably damaging Het
Kremen2 G T 17: 23,742,746 F262L probably damaging Het
Krtap9-1 T A 11: 99,873,751 C104* probably null Het
Ky A G 9: 102,527,903 Y199C probably damaging Het
L1td1 T G 4: 98,733,978 L259R probably damaging Het
Lrba A G 3: 86,353,755 T1473A probably benign Het
Lrp6 A T 6: 134,507,661 L333* probably null Het
Lrrc23 T C 6: 124,776,080 N201S probably benign Het
Map4k4 C A 1: 40,003,982 P666T possibly damaging Het
Matn1 T A 4: 130,952,203 D389E probably damaging Het
Mdc1 G T 17: 35,847,583 G285V probably benign Het
Mettl17 T C 14: 51,890,730 probably null Het
Mknk1 A T 4: 115,873,309 probably benign Het
Neurod1 A T 2: 79,454,086 F318I possibly damaging Het
Nfya T C 17: 48,392,417 T213A probably damaging Het
Nmrk1 C T 19: 18,639,538 T17M probably damaging Het
Ntrk1 A C 3: 87,786,089 D245E probably benign Het
Nup160 C A 2: 90,733,201 H1370Q possibly damaging Het
Olfr1151 T C 2: 87,857,817 V214A probably benign Het
Olfr745 A C 14: 50,643,246 K316Q probably benign Het
Olfr986 T A 9: 40,187,367 V84E probably damaging Het
Parp4 G A 14: 56,629,099 R1040H probably benign Het
Pdia4 C A 6: 47,808,266 E56* probably null Het
Pdia5 A G 16: 35,449,414 F175S probably damaging Het
Piezo2 C T 18: 63,109,885 S621N probably benign Het
Pigw T C 11: 84,877,817 T229A possibly damaging Het
Rasa3 T C 8: 13,576,381 Y734C probably benign Het
Rfx7 T A 9: 72,593,223 probably benign Het
Ros1 A G 10: 52,078,673 V1853A possibly damaging Het
Rps7 A G 12: 28,631,715 I139T probably benign Het
Sall3 T C 18: 80,986,493 D15G possibly damaging Het
Scn1a A T 2: 66,303,639 V137D probably benign Het
Slc23a3 G A 1: 75,129,529 P349S probably benign Het
Slc35a5 C G 16: 45,143,658 R404P probably damaging Het
Stard13 A T 5: 151,063,142 M301K probably benign Het
Suclg2 A G 6: 95,655,508 F60S probably damaging Het
Tecpr2 T A 12: 110,938,234 F887L possibly damaging Het
Tekt4 G T 17: 25,472,059 W113L probably damaging Het
Tep1 G A 14: 50,847,623 S901F probably damaging Het
Tex11 C T X: 101,015,585 V190I possibly damaging Het
Thbs1 T A 2: 118,119,476 probably null Het
Tm9sf4 T A 2: 153,198,375 V425D probably damaging Het
Tpo A G 12: 30,055,138 L911P possibly damaging Het
Ttn T C 2: 76,898,957 Q5332R unknown Het
Wdr59 A T 8: 111,496,834 D169E Het
Zfp799 C A 17: 32,820,192 G367C probably damaging Het
Other mutations in Rims1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Rims1 APN 1 22468242 missense probably damaging 1.00
IGL00535:Rims1 APN 1 22432921 missense probably benign 0.02
IGL01021:Rims1 APN 1 22486620 missense probably damaging 1.00
IGL01106:Rims1 APN 1 22379447 missense probably damaging 1.00
IGL01128:Rims1 APN 1 22534175 missense probably damaging 0.97
IGL01548:Rims1 APN 1 22538602 missense probably damaging 1.00
IGL01688:Rims1 APN 1 22397540 missense probably benign 0.22
IGL02089:Rims1 APN 1 22630475 missense possibly damaging 0.68
IGL02245:Rims1 APN 1 22346488 missense probably damaging 0.98
IGL02355:Rims1 APN 1 22483207 missense probably damaging 1.00
IGL02362:Rims1 APN 1 22483207 missense probably damaging 1.00
IGL02682:Rims1 APN 1 22288484 missense probably damaging 1.00
IGL03006:Rims1 APN 1 22296954 missense probably damaging 0.99
IGL03054:Rims1 UTSW 1 22290109 missense probably damaging 1.00
PIT4504001:Rims1 UTSW 1 22397460 missense
R0031:Rims1 UTSW 1 22296879 missense probably damaging 1.00
R0118:Rims1 UTSW 1 22346407 missense probably damaging 1.00
R0390:Rims1 UTSW 1 22596526 missense possibly damaging 0.92
R0483:Rims1 UTSW 1 22468182 splice site probably benign
R0744:Rims1 UTSW 1 22427459 splice site probably null
R0836:Rims1 UTSW 1 22427459 splice site probably null
R1218:Rims1 UTSW 1 22483175 missense probably damaging 1.00
R1228:Rims1 UTSW 1 22472756 missense probably null 1.00
R1374:Rims1 UTSW 1 22296948 missense probably damaging 1.00
R1474:Rims1 UTSW 1 22538281 splice site probably benign
R1652:Rims1 UTSW 1 22292866 missense probably damaging 1.00
R1712:Rims1 UTSW 1 22296948 missense probably damaging 1.00
R1730:Rims1 UTSW 1 22346529 critical splice acceptor site probably null
R1783:Rims1 UTSW 1 22346529 critical splice acceptor site probably null
R1861:Rims1 UTSW 1 22596558 missense probably damaging 1.00
R1899:Rims1 UTSW 1 22428474 missense probably damaging 1.00
R1937:Rims1 UTSW 1 22288530 missense probably damaging 1.00
R2010:Rims1 UTSW 1 22296996 missense probably damaging 1.00
R2049:Rims1 UTSW 1 22596435 missense probably damaging 1.00
R2124:Rims1 UTSW 1 22404508 nonsense probably null
R2860:Rims1 UTSW 1 22432976 missense probably benign 0.01
R2861:Rims1 UTSW 1 22432976 missense probably benign 0.01
R2914:Rims1 UTSW 1 22805630 missense probably damaging 1.00
R3740:Rims1 UTSW 1 22373443 missense probably damaging 1.00
R3741:Rims1 UTSW 1 22373443 missense probably damaging 1.00
R3773:Rims1 UTSW 1 22421810 missense probably damaging 1.00
R3874:Rims1 UTSW 1 22428489 missense probably damaging 1.00
R3901:Rims1 UTSW 1 22533497 missense probably benign 0.00
R3964:Rims1 UTSW 1 22427459 splice site probably null
R4037:Rims1 UTSW 1 22475712 missense probably damaging 0.96
R4039:Rims1 UTSW 1 22475712 missense probably damaging 0.96
R4056:Rims1 UTSW 1 22292939 splice site probably benign
R4062:Rims1 UTSW 1 22533583 missense probably benign 0.00
R4552:Rims1 UTSW 1 22373494 missense probably damaging 0.99
R4658:Rims1 UTSW 1 22427543 missense probably damaging 0.98
R4688:Rims1 UTSW 1 22479447 nonsense probably null
R4696:Rims1 UTSW 1 22288612 missense probably damaging 1.00
R4720:Rims1 UTSW 1 22427481 missense probably damaging 1.00
R4764:Rims1 UTSW 1 22479462 missense probably damaging 1.00
R4780:Rims1 UTSW 1 22291105 missense probably damaging 1.00
R4931:Rims1 UTSW 1 22533947 missense probably benign 0.26
R5137:Rims1 UTSW 1 22288620 nonsense probably null
R5153:Rims1 UTSW 1 22483247 nonsense probably null
R5305:Rims1 UTSW 1 22596542 missense probably damaging 0.99
R5354:Rims1 UTSW 1 22538511 missense probably damaging 1.00
R5386:Rims1 UTSW 1 22412245 missense probably damaging 0.99
R5485:Rims1 UTSW 1 22483208 missense possibly damaging 0.93
R5643:Rims1 UTSW 1 22538509 missense probably damaging 1.00
R5929:Rims1 UTSW 1 22468241 missense probably damaging 1.00
R5988:Rims1 UTSW 1 22596463 missense probably damaging 1.00
R6160:Rims1 UTSW 1 22432984 missense probably damaging 0.98
R6579:Rims1 UTSW 1 22425916 missense probably damaging 1.00
R6790:Rims1 UTSW 1 22468197 missense probably damaging 1.00
R7048:Rims1 UTSW 1 22472820 missense probably damaging 1.00
R7100:Rims1 UTSW 1 22346473 missense probably benign 0.27
R7155:Rims1 UTSW 1 22432923 missense probably damaging 0.99
R7171:Rims1 UTSW 1 22428489 missense
R7448:Rims1 UTSW 1 22404475 missense
R7505:Rims1 UTSW 1 22533996 missense possibly damaging 0.55
R7567:Rims1 UTSW 1 22468210 missense probably damaging 0.99
R7639:Rims1 UTSW 1 22805669 missense probably benign 0.02
R7955:Rims1 UTSW 1 22468241 missense probably damaging 1.00
R8005:Rims1 UTSW 1 22412213 missense
R8071:Rims1 UTSW 1 22288536 nonsense probably null
R8465:Rims1 UTSW 1 22428480 missense possibly damaging 0.89
R8517:Rims1 UTSW 1 22483165 missense probably damaging 1.00
R8703:Rims1 UTSW 1 22425887 missense
R9090:Rims1 UTSW 1 22428522 missense
R9179:Rims1 UTSW 1 22412266 missense probably damaging 0.99
R9271:Rims1 UTSW 1 22428522 missense
R9291:Rims1 UTSW 1 22397522 missense
R9394:Rims1 UTSW 1 22472775 missense probably damaging 1.00
R9578:Rims1 UTSW 1 22484742 missense probably damaging 1.00
R9614:Rims1 UTSW 1 22421745 nonsense probably null
R9726:Rims1 UTSW 1 22630412 missense probably null 0.21
Z1088:Rims1 UTSW 1 22288586 missense probably damaging 1.00
Z1176:Rims1 UTSW 1 22484671 nonsense probably null
Z1177:Rims1 UTSW 1 22296939 missense possibly damaging 0.93
Z1177:Rims1 UTSW 1 22468241 missense probably damaging 1.00
Z1177:Rims1 UTSW 1 22472777 missense probably benign 0.44
Z1177:Rims1 UTSW 1 22472804 missense probably damaging 1.00
Z1186:Rims1 UTSW 1 22379482 missense
Predicted Primers PCR Primer
(F):5'- TTCCAGGAATTCAGTCTACCCAAAC -3'
(R):5'- CACATGGTAGGACCTGTGTG -3'

Sequencing Primer
(F):5'- GGAATTCAGTCTACCCAAACTTTGC -3'
(R):5'- ACATGGTAGGACCTGTGTGTATGTG -3'
Posted On 2021-03-08