Incidental Mutation 'R8726:Olfr1151'
ID662405
Institutional Source Beutler Lab
Gene Symbol Olfr1151
Ensembl Gene ENSMUSG00000047039
Gene Nameolfactory receptor 1151
SynonymsMOR177-9, GA_x6K02T2Q125-49358694-49359620
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R8726 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location87855862-87859923 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87857817 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 214 (V214A)
Ref Sequence ENSEMBL: ENSMUSP00000151107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061081] [ENSMUST00000217376]
Predicted Effect probably benign
Transcript: ENSMUST00000061081
AA Change: V214A

PolyPhen 2 Score 0.138 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000055394
Gene: ENSMUSG00000047039
AA Change: V214A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.6e-45 PFAM
Pfam:7tm_1 41 290 1.7e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217376
AA Change: V214A

PolyPhen 2 Score 0.138 (Sensitivity: 0.92; Specificity: 0.86)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik A G 11: 69,898,381 S331P possibly damaging Het
4930433I11Rik A G 7: 40,994,802 M632V probably benign Het
9930111J21Rik2 A C 11: 49,019,680 V642G probably damaging Het
Acsbg1 T C 9: 54,618,178 E363G probably damaging Het
Ank3 T A 10: 69,987,254 H584Q Het
Ankrd11 A T 8: 122,894,026 L1029Q possibly damaging Het
Anpep C T 7: 79,840,893 V292I probably benign Het
Atmin G A 8: 116,954,786 D175N possibly damaging Het
B4galt6 T C 18: 20,688,393 I359M possibly damaging Het
Bicd2 A G 13: 49,379,429 D497G probably damaging Het
Camkk2 G T 5: 122,743,939 D418E probably benign Het
Cntn3 A T 6: 102,169,053 Y942* probably null Het
Col8a1 C T 16: 57,628,775 R124H probably damaging Het
Coro7 T C 16: 4,668,755 T185A possibly damaging Het
Creb3 C T 4: 43,566,747 P364S probably benign Het
Csf1r A T 18: 61,117,656 T480S probably benign Het
Csnk1g1 T A 9: 66,002,271 H223Q probably damaging Het
Ctns C T 11: 73,187,787 V171M probably benign Het
Dhx15 A T 5: 52,154,226 N637K probably benign Het
Eif4g1 T C 16: 20,675,482 Y103H probably damaging Het
Eif4g2 C T 7: 111,077,422 R295H probably damaging Het
Fam126b T C 1: 58,546,126 T171A possibly damaging Het
Fat1 C T 8: 45,024,169 P2084L probably benign Het
Fat4 A G 3: 39,010,498 R4868G probably damaging Het
Fbxo31 A T 8: 121,555,275 Y295* probably null Het
Fmn2 C A 1: 174,609,838 T1125N possibly damaging Het
Foxi2 C A 7: 135,410,404 P7Q probably damaging Het
Hmx1 C T 5: 35,391,756 P131L probably damaging Het
Hrh2 T C 13: 54,214,152 L49P probably damaging Het
Igkv6-14 A G 6: 70,435,141 V53A possibly damaging Het
Kcnb2 C A 1: 15,710,652 Q583K probably benign Het
Kcns3 A G 12: 11,091,691 S336P probably damaging Het
Kremen2 G T 17: 23,742,746 F262L probably damaging Het
Krtap9-1 T A 11: 99,873,751 C104* probably null Het
Ky A G 9: 102,527,903 Y199C probably damaging Het
L1td1 T G 4: 98,733,978 L259R probably damaging Het
Lrba A G 3: 86,353,755 T1473A probably benign Het
Lrp6 A T 6: 134,507,661 L333* probably null Het
Lrrc23 T C 6: 124,776,080 N201S probably benign Het
Map4k4 C A 1: 40,003,982 P666T possibly damaging Het
Matn1 T A 4: 130,952,203 D389E probably damaging Het
Mdc1 G T 17: 35,847,583 G285V probably benign Het
Mettl17 T C 14: 51,890,730 probably null Het
Neurod1 A T 2: 79,454,086 F318I possibly damaging Het
Nfya T C 17: 48,392,417 T213A probably damaging Het
Nmrk1 C T 19: 18,639,538 T17M probably damaging Het
Ntrk1 A C 3: 87,786,089 D245E probably benign Het
Nup160 C A 2: 90,733,201 H1370Q possibly damaging Het
Olfr745 A C 14: 50,643,246 K316Q probably benign Het
Olfr986 T A 9: 40,187,367 V84E probably damaging Het
Parp4 G A 14: 56,629,099 R1040H probably benign Het
Pdia4 C A 6: 47,808,266 E56* probably null Het
Pdia5 A G 16: 35,449,414 F175S probably damaging Het
Piezo2 C T 18: 63,109,885 S621N probably benign Het
Pigw T C 11: 84,877,817 T229A possibly damaging Het
Rasa3 T C 8: 13,576,381 Y734C probably benign Het
Rims1 T C 1: 22,594,100 D178G possibly damaging Het
Rps7 A G 12: 28,631,715 I139T probably benign Het
Sall3 T C 18: 80,986,493 D15G possibly damaging Het
Scn1a A T 2: 66,303,639 V137D probably benign Het
Slc23a3 G A 1: 75,129,529 P349S probably benign Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Stard13 A T 5: 151,063,142 M301K probably benign Het
Suclg2 A G 6: 95,655,508 F60S probably damaging Het
Tecpr2 T A 12: 110,938,234 F887L possibly damaging Het
Tekt4 G T 17: 25,472,059 W113L probably damaging Het
Tep1 G A 14: 50,847,623 S901F probably damaging Het
Tex11 C T X: 101,015,585 V190I possibly damaging Het
Thbs1 T A 2: 118,119,476 probably null Het
Tm9sf4 T A 2: 153,198,375 V425D probably damaging Het
Tpo A G 12: 30,055,138 L911P possibly damaging Het
Ttn T C 2: 76,898,957 Q5332R unknown Het
Wdr59 A T 8: 111,496,834 D169E Het
Zfp799 C A 17: 32,820,192 G367C probably damaging Het
Other mutations in Olfr1151
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01755:Olfr1151 APN 2 87857510 missense possibly damaging 0.60
IGL02314:Olfr1151 APN 2 87858056 missense probably damaging 1.00
R0127:Olfr1151 UTSW 2 87857483 missense probably benign
R0233:Olfr1151 UTSW 2 87857752 missense probably benign 0.19
R0233:Olfr1151 UTSW 2 87857752 missense probably benign 0.19
R0398:Olfr1151 UTSW 2 87858057 missense probably damaging 1.00
R1079:Olfr1151 UTSW 2 87857355 missense probably damaging 1.00
R1598:Olfr1151 UTSW 2 87857751 missense probably benign 0.01
R1965:Olfr1151 UTSW 2 87857415 missense probably benign 0.44
R3409:Olfr1151 UTSW 2 87857661 nonsense probably null
R4824:Olfr1151 UTSW 2 87857277 missense probably benign 0.24
R4962:Olfr1151 UTSW 2 87857288 missense probably benign 0.02
R4986:Olfr1151 UTSW 2 87857514 missense probably damaging 0.97
R5324:Olfr1151 UTSW 2 87857696 missense probably damaging 1.00
R5934:Olfr1151 UTSW 2 87857241 missense probably benign
R6335:Olfr1151 UTSW 2 87857467 nonsense probably null
R6389:Olfr1151 UTSW 2 87858023 missense probably damaging 1.00
R6958:Olfr1151 UTSW 2 87857951 missense probably damaging 1.00
R7329:Olfr1151 UTSW 2 87857241 missense probably benign
R8228:Olfr1151 UTSW 2 87857940 missense probably benign 0.12
R8506:Olfr1151 UTSW 2 87857837 missense probably damaging 1.00
R8845:Olfr1151 UTSW 2 87857201 missense probably benign 0.00
Z1177:Olfr1151 UTSW 2 87857424 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GGCAACAACAGATGGTTTGATAC -3'
(R):5'- AGGGTTCAACATTGGTATCACAAG -3'

Sequencing Primer
(F):5'- CATACAATTTTGGCATTCCGTTTGTG -3'
(R):5'- TCACAAGAGTATAGAACAGTGAAGTC -3'
Posted On2021-03-08