Incidental Mutation 'R8726:Lrba'
ID 662410
Institutional Source Beutler Lab
Gene Symbol Lrba
Ensembl Gene ENSMUSG00000028080
Gene Name LPS-responsive beige-like anchor
Synonyms Lba, D3Ertd775e
MMRRC Submission 068616-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8726 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 86131987-86689999 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 86261062 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1473 (T1473A)
Ref Sequence ENSEMBL: ENSMUSP00000103261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107635] [ENSMUST00000192145] [ENSMUST00000194759] [ENSMUST00000212390]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000107635
AA Change: T1473A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103261
Gene: ENSMUSG00000028080
AA Change: T1473A

DomainStartEndE-ValueType
low complexity region 12 31 N/A INTRINSIC
Pfam:Laminin_G_3 211 377 4.6e-13 PFAM
Pfam:DUF4704 446 717 2.5e-109 PFAM
coiled coil region 1019 1037 N/A INTRINSIC
low complexity region 1073 1089 N/A INTRINSIC
low complexity region 1100 1113 N/A INTRINSIC
low complexity region 1585 1600 N/A INTRINSIC
low complexity region 1614 1630 N/A INTRINSIC
low complexity region 1698 1713 N/A INTRINSIC
low complexity region 1738 1757 N/A INTRINSIC
low complexity region 1848 1861 N/A INTRINSIC
Pfam:DUF1088 1882 2049 7e-88 PFAM
Pfam:PH_BEACH 2075 2172 9.1e-31 PFAM
Beach 2203 2480 2.87e-207 SMART
WD40 2578 2615 7.4e0 SMART
WD40 2618 2661 1.72e0 SMART
WD40 2677 2716 3.99e-1 SMART
WD40 2760 2798 1.79e-1 SMART
WD40 2801 2840 4.28e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192145
AA Change: T1473A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142179
Gene: ENSMUSG00000028080
AA Change: T1473A

DomainStartEndE-ValueType
low complexity region 12 31 N/A INTRINSIC
Pfam:Laminin_G_3 205 377 7.4e-18 PFAM
coiled coil region 1019 1037 N/A INTRINSIC
low complexity region 1073 1089 N/A INTRINSIC
low complexity region 1100 1113 N/A INTRINSIC
low complexity region 1585 1600 N/A INTRINSIC
low complexity region 1614 1630 N/A INTRINSIC
low complexity region 1698 1713 N/A INTRINSIC
low complexity region 1738 1757 N/A INTRINSIC
low complexity region 1848 1861 N/A INTRINSIC
Pfam:DUF1088 1882 2050 1.5e-92 PFAM
Pfam:PH_BEACH 2068 2172 7.5e-32 PFAM
Beach 2203 2480 2.87e-207 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000194759
AA Change: T1473A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142043
Gene: ENSMUSG00000028080
AA Change: T1473A

DomainStartEndE-ValueType
low complexity region 12 31 N/A INTRINSIC
Pfam:Laminin_G_3 205 377 8.1e-18 PFAM
coiled coil region 1019 1037 N/A INTRINSIC
low complexity region 1073 1089 N/A INTRINSIC
low complexity region 1100 1113 N/A INTRINSIC
low complexity region 1585 1600 N/A INTRINSIC
low complexity region 1614 1630 N/A INTRINSIC
low complexity region 1698 1713 N/A INTRINSIC
low complexity region 1738 1757 N/A INTRINSIC
low complexity region 1848 1861 N/A INTRINSIC
Pfam:DUF1088 1882 2050 1.6e-92 PFAM
Pfam:PH_BEACH 2068 2172 8.3e-32 PFAM
Beach 2203 2480 2.87e-207 SMART
WD40 2578 2615 7.4e0 SMART
WD40 2618 2661 1.72e0 SMART
WD40 2677 2716 3.99e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212390
AA Change: T1473A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the WDL-BEACH-WD (WBW) gene family. Its expression is induced in B cells and macrophages by bacterial lipopolysaccharides (LPS). The encoded protein associates with protein kinase A and may be involved in leading intracellular vesicles to activated receptor complexes, which aids in the secretion and/or membrane deposition of immune effector molecules. Defects in this gene are associated with the disorder common variable immunodeficiency-8 with autoimmunity. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased numbers of myeloid-derived suppressor cells and regulatory T cells, abnormal NK cell physiology, impaired rejection of allogeneic, xenogeneic and missing self bone-marrow grafts, and resistance to acute graft vs host disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik A G 11: 69,789,207 (GRCm39) S331P possibly damaging Het
4930433I11Rik A G 7: 40,644,226 (GRCm39) M632V probably benign Het
9930111J21Rik2 A C 11: 48,910,507 (GRCm39) V642G probably damaging Het
Abcd4 A T 12: 84,651,171 (GRCm39) probably benign Het
Acsbg1 T C 9: 54,525,462 (GRCm39) E363G probably damaging Het
Ank3 T A 10: 69,823,084 (GRCm39) H584Q Het
Ankrd11 A T 8: 123,620,765 (GRCm39) L1029Q possibly damaging Het
Anpep C T 7: 79,490,641 (GRCm39) V292I probably benign Het
Atmin G A 8: 117,681,525 (GRCm39) D175N possibly damaging Het
B4galt6 T C 18: 20,821,450 (GRCm39) I359M possibly damaging Het
Bicd2 A G 13: 49,532,905 (GRCm39) D497G probably damaging Het
Calcr C T 6: 3,707,489 (GRCm39) probably benign Het
Camkk2 G T 5: 122,882,002 (GRCm39) D418E probably benign Het
Cntn3 A T 6: 102,146,014 (GRCm39) Y942* probably null Het
Col8a1 C T 16: 57,449,138 (GRCm39) R124H probably damaging Het
Coro7 T C 16: 4,486,619 (GRCm39) T185A possibly damaging Het
Creb3 C T 4: 43,566,747 (GRCm39) P364S probably benign Het
Csf1r A T 18: 61,250,728 (GRCm39) T480S probably benign Het
Csnk1g1 T A 9: 65,909,553 (GRCm39) H223Q probably damaging Het
Ctns C T 11: 73,078,613 (GRCm39) V171M probably benign Het
Dhx15 A T 5: 52,311,568 (GRCm39) N637K probably benign Het
Eif4g1 T C 16: 20,494,232 (GRCm39) Y103H probably damaging Het
Eif4g2 C T 7: 110,676,629 (GRCm39) R295H probably damaging Het
Fat1 C T 8: 45,477,206 (GRCm39) P2084L probably benign Het
Fat4 A G 3: 39,064,647 (GRCm39) R4868G probably damaging Het
Fbxo31 A T 8: 122,282,014 (GRCm39) Y295* probably null Het
Fmn2 C A 1: 174,437,404 (GRCm39) T1125N possibly damaging Het
Foxi2 C A 7: 135,012,133 (GRCm39) P7Q probably damaging Het
Hmx1 C T 5: 35,549,100 (GRCm39) P131L probably damaging Het
Hrh2 T C 13: 54,368,171 (GRCm39) L49P probably damaging Het
Hycc2 T C 1: 58,585,285 (GRCm39) T171A possibly damaging Het
Igkv6-14 A G 6: 70,412,125 (GRCm39) V53A possibly damaging Het
Kcnb2 C A 1: 15,780,876 (GRCm39) Q583K probably benign Het
Kcns3 A G 12: 11,141,692 (GRCm39) S336P probably damaging Het
Kremen2 G T 17: 23,961,720 (GRCm39) F262L probably damaging Het
Krtap9-1 T A 11: 99,764,577 (GRCm39) C104* probably null Het
Ky A G 9: 102,405,102 (GRCm39) Y199C probably damaging Het
L1td1 T G 4: 98,622,215 (GRCm39) L259R probably damaging Het
Lrp6 A T 6: 134,484,624 (GRCm39) L333* probably null Het
Lrrc23 T C 6: 124,753,043 (GRCm39) N201S probably benign Het
Map4k4 C A 1: 40,043,142 (GRCm39) P666T possibly damaging Het
Matn1 T A 4: 130,679,514 (GRCm39) D389E probably damaging Het
Mdc1 G T 17: 36,158,475 (GRCm39) G285V probably benign Het
Mettl17 T C 14: 52,128,187 (GRCm39) probably null Het
Mknk1 A T 4: 115,730,506 (GRCm39) probably benign Het
Neurod1 A T 2: 79,284,430 (GRCm39) F318I possibly damaging Het
Nfya T C 17: 48,699,445 (GRCm39) T213A probably damaging Het
Nmrk1 C T 19: 18,616,902 (GRCm39) T17M probably damaging Het
Ntrk1 A C 3: 87,693,396 (GRCm39) D245E probably benign Het
Nup160 C A 2: 90,563,545 (GRCm39) H1370Q possibly damaging Het
Or11h6 A C 14: 50,880,703 (GRCm39) K316Q probably benign Het
Or5w8 T C 2: 87,688,161 (GRCm39) V214A probably benign Het
Or6x1 T A 9: 40,098,663 (GRCm39) V84E probably damaging Het
Parp4 G A 14: 56,866,556 (GRCm39) R1040H probably benign Het
Pdia4 C A 6: 47,785,200 (GRCm39) E56* probably null Het
Pdia5 A G 16: 35,269,784 (GRCm39) F175S probably damaging Het
Piezo2 C T 18: 63,242,956 (GRCm39) S621N probably benign Het
Pigw T C 11: 84,768,643 (GRCm39) T229A possibly damaging Het
Rasa3 T C 8: 13,626,381 (GRCm39) Y734C probably benign Het
Rfx7 T A 9: 72,500,505 (GRCm39) probably benign Het
Rims1 T C 1: 22,633,181 (GRCm39) D178G possibly damaging Het
Ros1 A G 10: 51,954,769 (GRCm39) V1853A possibly damaging Het
Rps7 A G 12: 28,681,714 (GRCm39) I139T probably benign Het
Sall3 T C 18: 81,029,708 (GRCm39) D15G possibly damaging Het
Scn1a A T 2: 66,133,983 (GRCm39) V137D probably benign Het
Slc23a3 G A 1: 75,106,173 (GRCm39) P349S probably benign Het
Slc35a5 C G 16: 44,964,021 (GRCm39) R404P probably damaging Het
Stard13 A T 5: 150,986,607 (GRCm39) M301K probably benign Het
Suclg2 A G 6: 95,632,489 (GRCm39) F60S probably damaging Het
Tecpr2 T A 12: 110,904,668 (GRCm39) F887L possibly damaging Het
Tekt4 G T 17: 25,691,033 (GRCm39) W113L probably damaging Het
Tep1 G A 14: 51,085,080 (GRCm39) S901F probably damaging Het
Tex11 C T X: 100,059,191 (GRCm39) V190I possibly damaging Het
Thbs1 T A 2: 117,949,957 (GRCm39) probably null Het
Tm9sf4 T A 2: 153,040,295 (GRCm39) V425D probably damaging Het
Tpo A G 12: 30,105,137 (GRCm39) L911P possibly damaging Het
Ttn T C 2: 76,729,301 (GRCm39) Q5332R unknown Het
Wdr59 A T 8: 112,223,466 (GRCm39) D169E Het
Zfp799 C A 17: 33,039,166 (GRCm39) G367C probably damaging Het
Other mutations in Lrba
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Lrba APN 3 86,267,089 (GRCm39) missense probably benign 0.00
IGL00788:Lrba APN 3 86,234,992 (GRCm39) missense probably damaging 0.97
IGL01139:Lrba APN 3 86,549,969 (GRCm39) missense possibly damaging 0.88
IGL01302:Lrba APN 3 86,202,707 (GRCm39) missense probably damaging 1.00
IGL01612:Lrba APN 3 86,683,484 (GRCm39) missense possibly damaging 0.89
IGL01718:Lrba APN 3 86,258,555 (GRCm39) missense probably damaging 1.00
IGL01719:Lrba APN 3 86,234,903 (GRCm39) splice site probably benign
IGL01730:Lrba APN 3 86,648,731 (GRCm39) missense possibly damaging 0.89
IGL01735:Lrba APN 3 86,234,968 (GRCm39) missense probably benign 0.28
IGL01875:Lrba APN 3 86,217,354 (GRCm39) missense probably damaging 1.00
IGL01884:Lrba APN 3 86,217,719 (GRCm39) missense possibly damaging 0.86
IGL02264:Lrba APN 3 86,687,569 (GRCm39) missense probably damaging 0.99
IGL02638:Lrba APN 3 86,232,380 (GRCm39) missense probably damaging 0.97
IGL02647:Lrba APN 3 86,267,038 (GRCm39) missense probably benign 0.00
IGL02664:Lrba APN 3 86,233,038 (GRCm39) missense possibly damaging 0.84
IGL02728:Lrba APN 3 86,683,356 (GRCm39) missense probably damaging 0.99
IGL02730:Lrba APN 3 86,235,506 (GRCm39) missense probably damaging 1.00
IGL02883:Lrba APN 3 86,352,720 (GRCm39) missense probably damaging 0.99
IGL02883:Lrba APN 3 86,261,513 (GRCm39) missense probably damaging 1.00
IGL02948:Lrba APN 3 86,217,691 (GRCm39) splice site probably null
IGL03090:Lrba APN 3 86,680,448 (GRCm39) missense probably benign 0.01
molasses UTSW 3 86,261,614 (GRCm39) critical splice donor site probably null
oscar UTSW 3 86,257,611 (GRCm39) nonsense probably null
oscar2 UTSW 3 86,571,765 (GRCm39) nonsense probably null
P0023:Lrba UTSW 3 86,325,242 (GRCm39) missense probably damaging 1.00
PIT4802001:Lrba UTSW 3 86,571,801 (GRCm39) nonsense probably null
R0077:Lrba UTSW 3 86,449,995 (GRCm39) missense probably damaging 0.99
R0189:Lrba UTSW 3 86,275,816 (GRCm39) missense probably damaging 1.00
R0217:Lrba UTSW 3 86,550,029 (GRCm39) missense probably damaging 1.00
R0349:Lrba UTSW 3 86,447,312 (GRCm39) missense probably damaging 1.00
R0396:Lrba UTSW 3 86,202,486 (GRCm39) missense probably damaging 1.00
R0417:Lrba UTSW 3 86,622,961 (GRCm39) missense probably damaging 1.00
R0536:Lrba UTSW 3 86,622,839 (GRCm39) missense probably damaging 1.00
R0712:Lrba UTSW 3 86,205,297 (GRCm39) nonsense probably null
R0722:Lrba UTSW 3 86,513,296 (GRCm39) critical splice donor site probably null
R0828:Lrba UTSW 3 86,515,677 (GRCm39) splice site probably null
R0927:Lrba UTSW 3 86,687,540 (GRCm39) missense probably damaging 1.00
R1120:Lrba UTSW 3 86,202,499 (GRCm39) missense probably damaging 1.00
R1141:Lrba UTSW 3 86,526,865 (GRCm39) missense probably damaging 1.00
R1276:Lrba UTSW 3 86,571,833 (GRCm39) missense probably damaging 1.00
R1449:Lrba UTSW 3 86,261,585 (GRCm39) missense probably damaging 1.00
R1470:Lrba UTSW 3 86,644,449 (GRCm39) missense probably damaging 1.00
R1470:Lrba UTSW 3 86,644,449 (GRCm39) missense probably damaging 1.00
R1474:Lrba UTSW 3 86,687,573 (GRCm39) splice site probably benign
R1558:Lrba UTSW 3 86,258,622 (GRCm39) missense probably damaging 1.00
R1596:Lrba UTSW 3 86,257,611 (GRCm39) nonsense probably null
R1652:Lrba UTSW 3 86,447,245 (GRCm39) missense probably damaging 1.00
R1800:Lrba UTSW 3 86,259,175 (GRCm39) missense probably benign 0.00
R1819:Lrba UTSW 3 86,449,941 (GRCm39) missense possibly damaging 0.80
R1862:Lrba UTSW 3 86,680,510 (GRCm39) critical splice donor site probably null
R1917:Lrba UTSW 3 86,571,808 (GRCm39) missense probably damaging 1.00
R1965:Lrba UTSW 3 86,513,175 (GRCm39) critical splice acceptor site probably null
R1966:Lrba UTSW 3 86,513,175 (GRCm39) critical splice acceptor site probably null
R1969:Lrba UTSW 3 86,515,696 (GRCm39) missense probably damaging 0.99
R2011:Lrba UTSW 3 86,217,324 (GRCm39) missense probably damaging 0.99
R2179:Lrba UTSW 3 86,261,588 (GRCm39) missense probably damaging 1.00
R2186:Lrba UTSW 3 86,211,643 (GRCm39) missense probably damaging 1.00
R2281:Lrba UTSW 3 86,683,410 (GRCm39) missense possibly damaging 0.46
R2359:Lrba UTSW 3 86,256,057 (GRCm39) missense probably benign 0.01
R2412:Lrba UTSW 3 86,235,007 (GRCm39) missense probably damaging 1.00
R2496:Lrba UTSW 3 86,439,394 (GRCm39) missense probably damaging 1.00
R3153:Lrba UTSW 3 86,192,526 (GRCm39) missense probably damaging 0.99
R3708:Lrba UTSW 3 86,192,331 (GRCm39) missense possibly damaging 0.80
R3746:Lrba UTSW 3 86,283,260 (GRCm39) missense probably damaging 1.00
R3747:Lrba UTSW 3 86,283,260 (GRCm39) missense probably damaging 1.00
R3748:Lrba UTSW 3 86,283,260 (GRCm39) missense probably damaging 1.00
R3749:Lrba UTSW 3 86,283,260 (GRCm39) missense probably damaging 1.00
R3750:Lrba UTSW 3 86,283,260 (GRCm39) missense probably damaging 1.00
R3758:Lrba UTSW 3 86,683,356 (GRCm39) missense probably damaging 0.99
R3975:Lrba UTSW 3 86,258,562 (GRCm39) missense probably damaging 1.00
R4210:Lrba UTSW 3 86,267,433 (GRCm39) missense probably damaging 1.00
R4258:Lrba UTSW 3 86,352,656 (GRCm39) missense probably damaging 1.00
R4657:Lrba UTSW 3 86,644,471 (GRCm39) missense probably damaging 1.00
R4713:Lrba UTSW 3 86,267,175 (GRCm39) missense probably benign 0.13
R4716:Lrba UTSW 3 86,550,021 (GRCm39) missense probably damaging 0.99
R4811:Lrba UTSW 3 86,683,448 (GRCm39) missense probably damaging 1.00
R4827:Lrba UTSW 3 86,267,457 (GRCm39) missense possibly damaging 0.85
R4840:Lrba UTSW 3 86,526,816 (GRCm39) critical splice acceptor site probably null
R4920:Lrba UTSW 3 86,571,765 (GRCm39) nonsense probably null
R4948:Lrba UTSW 3 86,192,335 (GRCm39) missense probably damaging 1.00
R4970:Lrba UTSW 3 86,132,678 (GRCm39) missense probably benign 0.23
R4985:Lrba UTSW 3 86,234,743 (GRCm39) splice site probably null
R4993:Lrba UTSW 3 86,267,344 (GRCm39) missense probably damaging 1.00
R5107:Lrba UTSW 3 86,267,086 (GRCm39) missense possibly damaging 0.47
R5112:Lrba UTSW 3 86,132,678 (GRCm39) missense probably benign 0.23
R5122:Lrba UTSW 3 86,256,461 (GRCm39) nonsense probably null
R5155:Lrba UTSW 3 86,258,607 (GRCm39) missense probably benign 0.25
R5194:Lrba UTSW 3 86,235,526 (GRCm39) missense probably damaging 1.00
R5280:Lrba UTSW 3 86,232,329 (GRCm39) missense possibly damaging 0.94
R5445:Lrba UTSW 3 86,275,902 (GRCm39) missense probably benign
R5469:Lrba UTSW 3 86,449,948 (GRCm39) missense probably damaging 1.00
R5513:Lrba UTSW 3 86,449,948 (GRCm39) missense probably damaging 1.00
R5578:Lrba UTSW 3 86,664,814 (GRCm39) missense probably benign 0.27
R5740:Lrba UTSW 3 86,235,649 (GRCm39) missense probably damaging 1.00
R5868:Lrba UTSW 3 86,226,911 (GRCm39) missense probably damaging 1.00
R6104:Lrba UTSW 3 86,261,099 (GRCm39) missense probably damaging 1.00
R6166:Lrba UTSW 3 86,261,614 (GRCm39) critical splice donor site probably null
R6279:Lrba UTSW 3 86,256,171 (GRCm39) missense probably benign 0.26
R6330:Lrba UTSW 3 86,255,664 (GRCm39) missense probably benign 0.07
R6367:Lrba UTSW 3 86,275,869 (GRCm39) missense probably benign 0.42
R6571:Lrba UTSW 3 86,267,367 (GRCm39) missense probably damaging 1.00
R6584:Lrba UTSW 3 86,571,883 (GRCm39) missense probably damaging 1.00
R6698:Lrba UTSW 3 86,211,732 (GRCm39) missense probably damaging 0.99
R6763:Lrba UTSW 3 86,261,570 (GRCm39) missense probably damaging 1.00
R6834:Lrba UTSW 3 86,257,593 (GRCm39) missense probably benign 0.00
R6951:Lrba UTSW 3 86,653,180 (GRCm39) missense probably benign 0.01
R6969:Lrba UTSW 3 86,526,897 (GRCm39) missense probably benign 0.21
R7045:Lrba UTSW 3 86,192,398 (GRCm39) missense probably benign 0.03
R7133:Lrba UTSW 3 86,302,238 (GRCm39) splice site probably null
R7182:Lrba UTSW 3 86,648,765 (GRCm39) frame shift probably null
R7214:Lrba UTSW 3 86,235,633 (GRCm39) missense probably damaging 1.00
R7224:Lrba UTSW 3 86,302,553 (GRCm39) missense probably damaging 1.00
R7243:Lrba UTSW 3 86,658,823 (GRCm39) splice site probably null
R7350:Lrba UTSW 3 86,259,209 (GRCm39) missense probably damaging 0.96
R7380:Lrba UTSW 3 86,232,381 (GRCm39) missense probably damaging 1.00
R7492:Lrba UTSW 3 86,571,835 (GRCm39) missense probably damaging 1.00
R7651:Lrba UTSW 3 86,648,773 (GRCm39) nonsense probably null
R7729:Lrba UTSW 3 86,225,474 (GRCm39) missense probably damaging 1.00
R7754:Lrba UTSW 3 86,352,704 (GRCm39) missense probably damaging 1.00
R7762:Lrba UTSW 3 86,439,508 (GRCm39) missense probably damaging 0.99
R7855:Lrba UTSW 3 86,222,737 (GRCm39) missense possibly damaging 0.94
R7867:Lrba UTSW 3 86,275,896 (GRCm39) missense probably damaging 1.00
R7912:Lrba UTSW 3 86,622,872 (GRCm39) missense probably damaging 1.00
R7995:Lrba UTSW 3 86,526,858 (GRCm39) missense probably damaging 1.00
R8013:Lrba UTSW 3 86,325,278 (GRCm39) missense probably damaging 1.00
R8014:Lrba UTSW 3 86,325,278 (GRCm39) missense probably damaging 1.00
R8024:Lrba UTSW 3 86,202,708 (GRCm39) nonsense probably null
R8027:Lrba UTSW 3 86,325,219 (GRCm39) missense probably benign 0.05
R8090:Lrba UTSW 3 86,255,796 (GRCm39) missense probably benign
R8111:Lrba UTSW 3 86,235,012 (GRCm39) missense probably damaging 1.00
R8118:Lrba UTSW 3 86,261,533 (GRCm39) missense probably benign
R8204:Lrba UTSW 3 86,222,710 (GRCm39) missense possibly damaging 0.95
R8239:Lrba UTSW 3 86,449,882 (GRCm39) missense probably damaging 1.00
R8509:Lrba UTSW 3 86,255,483 (GRCm39) missense probably benign 0.04
R8532:Lrba UTSW 3 86,664,790 (GRCm39) missense probably damaging 1.00
R8744:Lrba UTSW 3 86,211,640 (GRCm39) missense probably benign 0.08
R8782:Lrba UTSW 3 86,549,976 (GRCm39) missense probably benign 0.00
R8784:Lrba UTSW 3 86,283,235 (GRCm39) missense probably damaging 1.00
R8922:Lrba UTSW 3 86,263,973 (GRCm39) missense probably damaging 1.00
R8964:Lrba UTSW 3 86,258,552 (GRCm39) missense probably benign 0.22
R8971:Lrba UTSW 3 86,522,388 (GRCm39) missense probably benign 0.00
R9046:Lrba UTSW 3 86,302,543 (GRCm39) missense possibly damaging 0.94
R9155:Lrba UTSW 3 86,202,508 (GRCm39) missense probably damaging 1.00
R9236:Lrba UTSW 3 86,261,066 (GRCm39) missense probably benign 0.05
R9266:Lrba UTSW 3 86,198,774 (GRCm39) missense probably benign 0.08
R9297:Lrba UTSW 3 86,280,873 (GRCm39) missense probably damaging 1.00
R9404:Lrba UTSW 3 86,205,224 (GRCm39) missense probably damaging 0.99
R9617:Lrba UTSW 3 86,267,169 (GRCm39) missense probably benign
R9640:Lrba UTSW 3 86,526,875 (GRCm39) nonsense probably null
R9779:Lrba UTSW 3 86,233,078 (GRCm39) missense probably damaging 1.00
X0065:Lrba UTSW 3 86,232,396 (GRCm39) missense possibly damaging 0.95
X0065:Lrba UTSW 3 86,205,206 (GRCm39) missense probably damaging 1.00
Z1176:Lrba UTSW 3 86,658,839 (GRCm39) missense possibly damaging 0.85
Z1176:Lrba UTSW 3 86,622,845 (GRCm39) missense probably benign 0.31
Z1177:Lrba UTSW 3 86,447,356 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- AAACACTAGGTGATAATCTAGGGAC -3'
(R):5'- CATGTTATGCTGACAGAAGAAAGTG -3'

Sequencing Primer
(F):5'- GGGACATTTTAGGAATTTACTCAAGG -3'
(R):5'- GGCTATTTTAGAACCCATGTCAGGC -3'
Posted On 2021-03-08