Mutagenetix > Incidental Mutation

Incidental Mutation 'R8726:Lrba'

662410

Institutional Source

Beutler Lab

Gene Symbol

Lrba

Ensembl Gene

ENSMUSG00000028080

Gene Name

LPS-responsive beige-like anchor

Synonyms

Lba, D3Ertd775e

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8726 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

86224680-86782692 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 86353755 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1473 (T1473A)

Ref Sequence

ENSEMBL: ENSMUSP00000103261 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107635] [ENSMUST00000192145] [ENSMUST00000194759] [ENSMUST00000212390]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000107635
AA Change: T1473A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000103261
Gene: ENSMUSG00000028080
AA Change: T1473A

Domain	Start	End	E-Value	Type
low complexity region	12	31	N/A	INTRINSIC
Pfam:Laminin_G_3	211	377	4.6e-13	PFAM
Pfam:DUF4704	446	717	2.5e-109	PFAM
coiled coil region	1019	1037	N/A	INTRINSIC
low complexity region	1073	1089	N/A	INTRINSIC
low complexity region	1100	1113	N/A	INTRINSIC
low complexity region	1585	1600	N/A	INTRINSIC
low complexity region	1614	1630	N/A	INTRINSIC
low complexity region	1698	1713	N/A	INTRINSIC
low complexity region	1738	1757	N/A	INTRINSIC
low complexity region	1848	1861	N/A	INTRINSIC
Pfam:DUF1088	1882	2049	7e-88	PFAM
Pfam:PH_BEACH	2075	2172	9.1e-31	PFAM
Beach	2203	2480	2.87e-207	SMART
WD40	2578	2615	7.4e0	SMART
WD40	2618	2661	1.72e0	SMART
WD40	2677	2716	3.99e-1	SMART
WD40	2760	2798	1.79e-1	SMART
WD40	2801	2840	4.28e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000192145
AA Change: T1473A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000142179
Gene: ENSMUSG00000028080
AA Change: T1473A

Domain	Start	End	E-Value	Type
low complexity region	12	31	N/A	INTRINSIC
Pfam:Laminin_G_3	205	377	7.4e-18	PFAM
coiled coil region	1019	1037	N/A	INTRINSIC
low complexity region	1073	1089	N/A	INTRINSIC
low complexity region	1100	1113	N/A	INTRINSIC
low complexity region	1585	1600	N/A	INTRINSIC
low complexity region	1614	1630	N/A	INTRINSIC
low complexity region	1698	1713	N/A	INTRINSIC
low complexity region	1738	1757	N/A	INTRINSIC
low complexity region	1848	1861	N/A	INTRINSIC
Pfam:DUF1088	1882	2050	1.5e-92	PFAM
Pfam:PH_BEACH	2068	2172	7.5e-32	PFAM
Beach	2203	2480	2.87e-207	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000194759
AA Change: T1473A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000142043
Gene: ENSMUSG00000028080
AA Change: T1473A

Domain	Start	End	E-Value	Type
low complexity region	12	31	N/A	INTRINSIC
Pfam:Laminin_G_3	205	377	8.1e-18	PFAM
coiled coil region	1019	1037	N/A	INTRINSIC
low complexity region	1073	1089	N/A	INTRINSIC
low complexity region	1100	1113	N/A	INTRINSIC
low complexity region	1585	1600	N/A	INTRINSIC
low complexity region	1614	1630	N/A	INTRINSIC
low complexity region	1698	1713	N/A	INTRINSIC
low complexity region	1738	1757	N/A	INTRINSIC
low complexity region	1848	1861	N/A	INTRINSIC
Pfam:DUF1088	1882	2050	1.6e-92	PFAM
Pfam:PH_BEACH	2068	2172	8.3e-32	PFAM
Beach	2203	2480	2.87e-207	SMART
WD40	2578	2615	7.4e0	SMART
WD40	2618	2661	1.72e0	SMART
WD40	2677	2716	3.99e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000212390
AA Change: T1473A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

100% (76/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the WDL-BEACH-WD (WBW) gene family. Its expression is induced in B cells and macrophages by bacterial lipopolysaccharides (LPS). The encoded protein associates with protein kinase A and may be involved in leading intracellular vesicles to activated receptor complexes, which aids in the secretion and/or membrane deposition of immune effector molecules. Defects in this gene are associated with the disorder common variable immunodeficiency-8 with autoimmunity. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased numbers of myeloid-derived suppressor cells and regulatory T cells, abnormal NK cell physiology, impaired rejection of allogeneic, xenogeneic and missing self bone-marrow grafts, and resistance to acute graft vs host disease. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810408A11Rik	A	G	11: 69,898,381	S331P	possibly damaging	Het
4930433I11Rik	A	G	7: 40,994,802	M632V	probably benign	Het
9930111J21Rik2	A	C	11: 49,019,680	V642G	probably damaging	Het
Abcd4	A	T	12: 84,604,397		probably benign	Het
Acsbg1	T	C	9: 54,618,178	E363G	probably damaging	Het
Ank3	T	A	10: 69,987,254	H584Q		Het
Ankrd11	A	T	8: 122,894,026	L1029Q	possibly damaging	Het
Anpep	C	T	7: 79,840,893	V292I	probably benign	Het
Atmin	G	A	8: 116,954,786	D175N	possibly damaging	Het
B4galt6	T	C	18: 20,688,393	I359M	possibly damaging	Het
Bicd2	A	G	13: 49,379,429	D497G	probably damaging	Het
Calcr	C	T	6: 3,707,489		probably benign	Het
Camkk2	G	T	5: 122,743,939	D418E	probably benign	Het
Cntn3	A	T	6: 102,169,053	Y942*	probably null	Het
Col8a1	C	T	16: 57,628,775	R124H	probably damaging	Het
Coro7	T	C	16: 4,668,755	T185A	possibly damaging	Het
Creb3	C	T	4: 43,566,747	P364S	probably benign	Het
Csf1r	A	T	18: 61,117,656	T480S	probably benign	Het
Csnk1g1	T	A	9: 66,002,271	H223Q	probably damaging	Het
Ctns	C	T	11: 73,187,787	V171M	probably benign	Het
Dhx15	A	T	5: 52,154,226	N637K	probably benign	Het
Eif4g1	T	C	16: 20,675,482	Y103H	probably damaging	Het
Eif4g2	C	T	7: 111,077,422	R295H	probably damaging	Het
Fam126b	T	C	1: 58,546,126	T171A	possibly damaging	Het
Fat1	C	T	8: 45,024,169	P2084L	probably benign	Het
Fat4	A	G	3: 39,010,498	R4868G	probably damaging	Het
Fbxo31	A	T	8: 121,555,275	Y295*	probably null	Het
Fmn2	C	A	1: 174,609,838	T1125N	possibly damaging	Het
Foxi2	C	A	7: 135,410,404	P7Q	probably damaging	Het
Hmx1	C	T	5: 35,391,756	P131L	probably damaging	Het
Hrh2	T	C	13: 54,214,152	L49P	probably damaging	Het
Igkv6-14	A	G	6: 70,435,141	V53A	possibly damaging	Het
Kcnb2	C	A	1: 15,710,652	Q583K	probably benign	Het
Kcns3	A	G	12: 11,091,691	S336P	probably damaging	Het
Kremen2	G	T	17: 23,742,746	F262L	probably damaging	Het
Krtap9-1	T	A	11: 99,873,751	C104*	probably null	Het
Ky	A	G	9: 102,527,903	Y199C	probably damaging	Het
L1td1	T	G	4: 98,733,978	L259R	probably damaging	Het
Lrp6	A	T	6: 134,507,661	L333*	probably null	Het
Lrrc23	T	C	6: 124,776,080	N201S	probably benign	Het
Map4k4	C	A	1: 40,003,982	P666T	possibly damaging	Het
Matn1	T	A	4: 130,952,203	D389E	probably damaging	Het
Mdc1	G	T	17: 35,847,583	G285V	probably benign	Het
Mettl17	T	C	14: 51,890,730		probably null	Het
Mknk1	A	T	4: 115,873,309		probably benign	Het
Neurod1	A	T	2: 79,454,086	F318I	possibly damaging	Het
Nfya	T	C	17: 48,392,417	T213A	probably damaging	Het
Nmrk1	C	T	19: 18,639,538	T17M	probably damaging	Het
Ntrk1	A	C	3: 87,786,089	D245E	probably benign	Het
Nup160	C	A	2: 90,733,201	H1370Q	possibly damaging	Het
Olfr1151	T	C	2: 87,857,817	V214A	probably benign	Het
Olfr745	A	C	14: 50,643,246	K316Q	probably benign	Het
Olfr986	T	A	9: 40,187,367	V84E	probably damaging	Het
Parp4	G	A	14: 56,629,099	R1040H	probably benign	Het
Pdia4	C	A	6: 47,808,266	E56*	probably null	Het
Pdia5	A	G	16: 35,449,414	F175S	probably damaging	Het
Piezo2	C	T	18: 63,109,885	S621N	probably benign	Het
Pigw	T	C	11: 84,877,817	T229A	possibly damaging	Het
Rasa3	T	C	8: 13,576,381	Y734C	probably benign	Het
Rfx7	T	A	9: 72,593,223		probably benign	Het
Rims1	T	C	1: 22,594,100	D178G	possibly damaging	Het
Ros1	A	G	10: 52,078,673	V1853A	possibly damaging	Het
Rps7	A	G	12: 28,631,715	I139T	probably benign	Het
Sall3	T	C	18: 80,986,493	D15G	possibly damaging	Het
Scn1a	A	T	2: 66,303,639	V137D	probably benign	Het
Slc23a3	G	A	1: 75,129,529	P349S	probably benign	Het
Slc35a5	C	G	16: 45,143,658	R404P	probably damaging	Het
Stard13	A	T	5: 151,063,142	M301K	probably benign	Het
Suclg2	A	G	6: 95,655,508	F60S	probably damaging	Het
Tecpr2	T	A	12: 110,938,234	F887L	possibly damaging	Het
Tekt4	G	T	17: 25,472,059	W113L	probably damaging	Het
Tep1	G	A	14: 50,847,623	S901F	probably damaging	Het
Tex11	C	T	X: 101,015,585	V190I	possibly damaging	Het
Thbs1	T	A	2: 118,119,476		probably null	Het
Tm9sf4	T	A	2: 153,198,375	V425D	probably damaging	Het
Tpo	A	G	12: 30,055,138	L911P	possibly damaging	Het
Ttn	T	C	2: 76,898,957	Q5332R	unknown	Het
Wdr59	A	T	8: 111,496,834	D169E		Het
Zfp799	C	A	17: 32,820,192	G367C	probably damaging	Het

Other mutations in Lrba

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Lrba	APN	3	86359782	missense	probably benign	0.00
IGL00788:Lrba	APN	3	86327685	missense	probably damaging	0.97
IGL01139:Lrba	APN	3	86642662	missense	possibly damaging	0.88
IGL01302:Lrba	APN	3	86295400	missense	probably damaging	1.00
IGL01612:Lrba	APN	3	86776177	missense	possibly damaging	0.89
IGL01718:Lrba	APN	3	86351248	missense	probably damaging	1.00
IGL01719:Lrba	APN	3	86327596	splice site	probably benign
IGL01730:Lrba	APN	3	86741424	missense	possibly damaging	0.89
IGL01735:Lrba	APN	3	86327661	missense	probably benign	0.28
IGL01875:Lrba	APN	3	86310047	missense	probably damaging	1.00
IGL01884:Lrba	APN	3	86310412	missense	possibly damaging	0.86
IGL02264:Lrba	APN	3	86780262	missense	probably damaging	0.99
IGL02638:Lrba	APN	3	86325073	missense	probably damaging	0.97
IGL02647:Lrba	APN	3	86359731	missense	probably benign	0.00
IGL02664:Lrba	APN	3	86325731	missense	possibly damaging	0.84
IGL02728:Lrba	APN	3	86776049	missense	probably damaging	0.99
IGL02730:Lrba	APN	3	86328199	missense	probably damaging	1.00
IGL02883:Lrba	APN	3	86354206	missense	probably damaging	1.00
IGL02883:Lrba	APN	3	86445413	missense	probably damaging	0.99
IGL02948:Lrba	APN	3	86310384	splice site	probably null
IGL03090:Lrba	APN	3	86773141	missense	probably benign	0.01
molasses	UTSW	3	86354307	critical splice donor site	probably null
oscar	UTSW	3	86350304	nonsense	probably null
oscar2	UTSW	3	86664458	nonsense	probably null
P0023:Lrba	UTSW	3	86417935	missense	probably damaging	1.00
PIT4802001:Lrba	UTSW	3	86664494	nonsense	probably null
R0077:Lrba	UTSW	3	86542688	missense	probably damaging	0.99
R0189:Lrba	UTSW	3	86368509	missense	probably damaging	1.00
R0217:Lrba	UTSW	3	86642722	missense	probably damaging	1.00
R0349:Lrba	UTSW	3	86540005	missense	probably damaging	1.00
R0396:Lrba	UTSW	3	86295179	missense	probably damaging	1.00
R0417:Lrba	UTSW	3	86715654	missense	probably damaging	1.00
R0536:Lrba	UTSW	3	86715532	missense	probably damaging	1.00
R0712:Lrba	UTSW	3	86297990	nonsense	probably null
R0722:Lrba	UTSW	3	86605989	critical splice donor site	probably null
R0828:Lrba	UTSW	3	86608370	splice site	probably null
R0927:Lrba	UTSW	3	86780233	missense	probably damaging	1.00
R1120:Lrba	UTSW	3	86295192	missense	probably damaging	1.00
R1141:Lrba	UTSW	3	86619558	missense	probably damaging	1.00
R1276:Lrba	UTSW	3	86664526	missense	probably damaging	1.00
R1449:Lrba	UTSW	3	86354278	missense	probably damaging	1.00
R1470:Lrba	UTSW	3	86737142	missense	probably damaging	1.00
R1470:Lrba	UTSW	3	86737142	missense	probably damaging	1.00
R1474:Lrba	UTSW	3	86780266	splice site	probably benign
R1558:Lrba	UTSW	3	86351315	missense	probably damaging	1.00
R1596:Lrba	UTSW	3	86350304	nonsense	probably null
R1652:Lrba	UTSW	3	86539938	missense	probably damaging	1.00
R1800:Lrba	UTSW	3	86351868	missense	probably benign	0.00
R1819:Lrba	UTSW	3	86542634	missense	possibly damaging	0.80
R1862:Lrba	UTSW	3	86773203	critical splice donor site	probably null
R1917:Lrba	UTSW	3	86664501	missense	probably damaging	1.00
R1965:Lrba	UTSW	3	86605868	critical splice acceptor site	probably null
R1966:Lrba	UTSW	3	86605868	critical splice acceptor site	probably null
R1969:Lrba	UTSW	3	86608389	missense	probably damaging	0.99
R2011:Lrba	UTSW	3	86310017	missense	probably damaging	0.99
R2179:Lrba	UTSW	3	86354281	missense	probably damaging	1.00
R2186:Lrba	UTSW	3	86304336	missense	probably damaging	1.00
R2281:Lrba	UTSW	3	86776103	missense	possibly damaging	0.46
R2359:Lrba	UTSW	3	86348750	missense	probably benign	0.01
R2412:Lrba	UTSW	3	86327700	missense	probably damaging	1.00
R2496:Lrba	UTSW	3	86532087	missense	probably damaging	1.00
R3153:Lrba	UTSW	3	86285219	missense	probably damaging	0.99
R3708:Lrba	UTSW	3	86285024	missense	possibly damaging	0.80
R3746:Lrba	UTSW	3	86375953	missense	probably damaging	1.00
R3747:Lrba	UTSW	3	86375953	missense	probably damaging	1.00
R3748:Lrba	UTSW	3	86375953	missense	probably damaging	1.00
R3749:Lrba	UTSW	3	86375953	missense	probably damaging	1.00
R3750:Lrba	UTSW	3	86375953	missense	probably damaging	1.00
R3758:Lrba	UTSW	3	86776049	missense	probably damaging	0.99
R3975:Lrba	UTSW	3	86351255	missense	probably damaging	1.00
R4210:Lrba	UTSW	3	86360126	missense	probably damaging	1.00
R4258:Lrba	UTSW	3	86445349	missense	probably damaging	1.00
R4657:Lrba	UTSW	3	86737164	missense	probably damaging	1.00
R4713:Lrba	UTSW	3	86359868	missense	probably benign	0.13
R4716:Lrba	UTSW	3	86642714	missense	probably damaging	0.99
R4811:Lrba	UTSW	3	86776141	missense	probably damaging	1.00
R4827:Lrba	UTSW	3	86360150	missense	possibly damaging	0.85
R4840:Lrba	UTSW	3	86619509	critical splice acceptor site	probably null
R4920:Lrba	UTSW	3	86664458	nonsense	probably null
R4948:Lrba	UTSW	3	86285028	missense	probably damaging	1.00
R4970:Lrba	UTSW	3	86225371	missense	probably benign	0.23
R4985:Lrba	UTSW	3	86327436	splice site	probably null
R4993:Lrba	UTSW	3	86360037	missense	probably damaging	1.00
R5107:Lrba	UTSW	3	86359779	missense	possibly damaging	0.47
R5112:Lrba	UTSW	3	86225371	missense	probably benign	0.23
R5122:Lrba	UTSW	3	86349154	nonsense	probably null
R5155:Lrba	UTSW	3	86351300	missense	probably benign	0.25
R5194:Lrba	UTSW	3	86328219	missense	probably damaging	1.00
R5280:Lrba	UTSW	3	86325022	missense	possibly damaging	0.94
R5445:Lrba	UTSW	3	86368595	missense	probably benign
R5469:Lrba	UTSW	3	86542641	missense	probably damaging	1.00
R5513:Lrba	UTSW	3	86542641	missense	probably damaging	1.00
R5578:Lrba	UTSW	3	86757507	missense	probably benign	0.27
R5740:Lrba	UTSW	3	86328342	missense	probably damaging	1.00
R5868:Lrba	UTSW	3	86319604	missense	probably damaging	1.00
R6104:Lrba	UTSW	3	86353792	missense	probably damaging	1.00
R6166:Lrba	UTSW	3	86354307	critical splice donor site	probably null
R6279:Lrba	UTSW	3	86348864	missense	probably benign	0.26
R6330:Lrba	UTSW	3	86348357	missense	probably benign	0.07
R6367:Lrba	UTSW	3	86368562	missense	probably benign	0.42
R6571:Lrba	UTSW	3	86360060	missense	probably damaging	1.00
R6584:Lrba	UTSW	3	86664576	missense	probably damaging	1.00
R6698:Lrba	UTSW	3	86304425	missense	probably damaging	0.99
R6763:Lrba	UTSW	3	86354263	missense	probably damaging	1.00
R6834:Lrba	UTSW	3	86350286	missense	probably benign	0.00
R6951:Lrba	UTSW	3	86745873	missense	probably benign	0.01
R6969:Lrba	UTSW	3	86619590	missense	probably benign	0.21
R7045:Lrba	UTSW	3	86285091	missense	probably benign	0.03
R7133:Lrba	UTSW	3	86394931	splice site	probably null
R7182:Lrba	UTSW	3	86741458	frame shift	probably null
R7214:Lrba	UTSW	3	86328326	missense	probably damaging	1.00
R7224:Lrba	UTSW	3	86395246	missense	probably damaging	1.00
R7243:Lrba	UTSW	3	86751516	splice site	probably null
R7350:Lrba	UTSW	3	86351902	missense	probably damaging	0.96
R7380:Lrba	UTSW	3	86325074	missense	probably damaging	1.00
R7492:Lrba	UTSW	3	86664528	missense	probably damaging	1.00
R7651:Lrba	UTSW	3	86741466	nonsense	probably null
R7729:Lrba	UTSW	3	86318167	missense	probably damaging	1.00
R7754:Lrba	UTSW	3	86445397	missense	probably damaging	1.00
R7762:Lrba	UTSW	3	86532201	missense	probably damaging	0.99
R7855:Lrba	UTSW	3	86315430	missense	possibly damaging	0.94
R7867:Lrba	UTSW	3	86368589	missense	probably damaging	1.00
R7912:Lrba	UTSW	3	86715565	missense	probably damaging	1.00
R7995:Lrba	UTSW	3	86619551	missense	probably damaging	1.00
R8013:Lrba	UTSW	3	86417971	missense	probably damaging	1.00
R8014:Lrba	UTSW	3	86417971	missense	probably damaging	1.00
R8024:Lrba	UTSW	3	86295401	nonsense	probably null
R8027:Lrba	UTSW	3	86417912	missense	probably benign	0.05
R8090:Lrba	UTSW	3	86348489	missense	probably benign
R8111:Lrba	UTSW	3	86327705	missense	probably damaging	1.00
R8118:Lrba	UTSW	3	86354226	missense	probably benign
R8204:Lrba	UTSW	3	86315403	missense	possibly damaging	0.95
R8239:Lrba	UTSW	3	86542575	missense	probably damaging	1.00
R8509:Lrba	UTSW	3	86348176	missense	probably benign	0.04
R8532:Lrba	UTSW	3	86757483	missense	probably damaging	1.00
R8744:Lrba	UTSW	3	86304333	missense	probably benign	0.08
R8782:Lrba	UTSW	3	86642669	missense	probably benign	0.00
R8784:Lrba	UTSW	3	86375928	missense	probably damaging	1.00
R8922:Lrba	UTSW	3	86356666	missense	probably damaging	1.00
R8964:Lrba	UTSW	3	86351245	missense	probably benign	0.22
R8971:Lrba	UTSW	3	86615081	missense	probably benign	0.00
R9046:Lrba	UTSW	3	86395236	missense	possibly damaging	0.94
R9155:Lrba	UTSW	3	86295201	missense	probably damaging	1.00
R9236:Lrba	UTSW	3	86353759	missense	probably benign	0.05
R9266:Lrba	UTSW	3	86291467	missense	probably benign	0.08
R9297:Lrba	UTSW	3	86373566	missense	probably damaging	1.00
R9404:Lrba	UTSW	3	86297917	missense	probably damaging	0.99
R9617:Lrba	UTSW	3	86359862	missense	probably benign
R9640:Lrba	UTSW	3	86619568	nonsense	probably null
R9779:Lrba	UTSW	3	86325771	missense	probably damaging	1.00
X0065:Lrba	UTSW	3	86297899	missense	probably damaging	1.00
X0065:Lrba	UTSW	3	86325089	missense	possibly damaging	0.95
Z1176:Lrba	UTSW	3	86715538	missense	probably benign	0.31
Z1176:Lrba	UTSW	3	86751532	missense	possibly damaging	0.85
Z1177:Lrba	UTSW	3	86540049	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- AAACACTAGGTGATAATCTAGGGAC -3'
(R):5'- CATGTTATGCTGACAGAAGAAAGTG -3'

Sequencing Primer
(F):5'- GGGACATTTTAGGAATTTACTCAAGG -3'
(R):5'- GGCTATTTTAGAACCCATGTCAGGC -3'

Posted On

2021-03-08