Incidental Mutation 'R8726:Creb3'
ID662412
Institutional Source Beutler Lab
Gene Symbol Creb3
Ensembl Gene ENSMUSG00000028466
Gene NamecAMP responsive element binding protein 3
SynonymsLZIP, LZIP-1, Luman, LZIP-2
Accession Numbers

NCBI RefSeq: NM_013497.3; MGI: 99946

Is this an essential gene? Probably essential (E-score: 0.801) question?
Stock #R8726 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location43562332-43567060 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 43566747 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 364 (P364S)
Ref Sequence ENSEMBL: ENSMUSP00000100008 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030187] [ENSMUST00000030189] [ENSMUST00000102944] [ENSMUST00000130443] [ENSMUST00000132631] [ENSMUST00000167751]
Predicted Effect probably benign
Transcript: ENSMUST00000030187
SMART Domains Protein: ENSMUSP00000030187
Gene: ENSMUSG00000028465

DomainStartEndE-ValueType
Blast:B41 2 76 5e-31 BLAST
B41 82 313 4.66e-73 SMART
IRS 308 401 7.65e-16 SMART
Pfam:Talin_middle 491 652 8.2e-60 PFAM
low complexity region 671 690 N/A INTRINSIC
internal_repeat_2 699 760 8.94e-6 PROSPERO
low complexity region 766 775 N/A INTRINSIC
PDB:1ZVZ|B 820 844 2e-7 PDB
low complexity region 866 879 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
PDB:2LQG|A 913 1044 2e-44 PDB
PDB:2L7N|A 1046 1207 1e-101 PDB
Pfam:VBS 1234 1358 9.6e-8 PFAM
internal_repeat_2 1488 1549 8.94e-6 PROSPERO
internal_repeat_3 1623 1769 4.92e-5 PROSPERO
low complexity region 1817 1828 N/A INTRINSIC
Pfam:VBS 1849 1973 6.2e-67 PFAM
PDB:3DYJ|B 1974 2293 N/A PDB
low complexity region 2305 2327 N/A INTRINSIC
ILWEQ 2336 2533 2.93e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000030189
SMART Domains Protein: ENSMUSP00000030189
Gene: ENSMUSG00000028467

DomainStartEndE-ValueType
Pfam:GBA2_N 142 446 9.4e-106 PFAM
Pfam:DUF608 512 879 1.3e-153 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102944
AA Change: P364S

PolyPhen 2 Score 0.308 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000100008
Gene: ENSMUSG00000028466
AA Change: P364S

DomainStartEndE-ValueType
low complexity region 54 83 N/A INTRINSIC
low complexity region 132 147 N/A INTRINSIC
BRLZ 158 222 2.03e-15 SMART
low complexity region 240 253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130443
SMART Domains Protein: ENSMUSP00000119589
Gene: ENSMUSG00000028467

DomainStartEndE-ValueType
Pfam:GBA2_N 142 180 5.6e-13 PFAM
Pfam:GBA2_N 178 227 1.5e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132631
Predicted Effect possibly damaging
Transcript: ENSMUST00000167751
AA Change: P388S

PolyPhen 2 Score 0.501 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000129401
Gene: ENSMUSG00000028466
AA Change: P388S

DomainStartEndE-ValueType
low complexity region 54 83 N/A INTRINSIC
low complexity region 156 171 N/A INTRINSIC
BRLZ 182 246 2.03e-15 SMART
low complexity region 264 277 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that is a member of the leucine zipper family of DNA binding proteins. This protein binds to the cAMP-response element and regulates cell proliferation. The protein interacts with host cell factor C1, which also associates with the herpes simplex virus (HSV) protein VP16 that induces transcription of HSV immediate-early genes. This protein and VP16 both bind to the same site on host cell factor C1. It is thought that the interaction between this protein and host cell factor C1 plays a role in the establishment of latency during HSV infection. This protein also plays a role in leukocyte migration, tumor suppression, and endoplasmic reticulum stress-associated protein degradation. Additional transcript variants have been identified, but their biological validity has not been determined.[provided by RefSeq, Nov 2009]
Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik A G 11: 69,898,381 S331P possibly damaging Het
4930433I11Rik A G 7: 40,994,802 M632V probably benign Het
9930111J21Rik2 A C 11: 49,019,680 V642G probably damaging Het
Acsbg1 T C 9: 54,618,178 E363G probably damaging Het
Ank3 T A 10: 69,987,254 H584Q Het
Ankrd11 A T 8: 122,894,026 L1029Q possibly damaging Het
Anpep C T 7: 79,840,893 V292I probably benign Het
Atmin G A 8: 116,954,786 D175N possibly damaging Het
B4galt6 T C 18: 20,688,393 I359M possibly damaging Het
Bicd2 A G 13: 49,379,429 D497G probably damaging Het
Camkk2 G T 5: 122,743,939 D418E probably benign Het
Cntn3 A T 6: 102,169,053 Y942* probably null Het
Col8a1 C T 16: 57,628,775 R124H probably damaging Het
Coro7 T C 16: 4,668,755 T185A possibly damaging Het
Csf1r A T 18: 61,117,656 T480S probably benign Het
Csnk1g1 T A 9: 66,002,271 H223Q probably damaging Het
Ctns C T 11: 73,187,787 V171M probably benign Het
Dhx15 A T 5: 52,154,226 N637K probably benign Het
Eif4g1 T C 16: 20,675,482 Y103H probably damaging Het
Eif4g2 C T 7: 111,077,422 R295H probably damaging Het
Fam126b T C 1: 58,546,126 T171A possibly damaging Het
Fat1 C T 8: 45,024,169 P2084L probably benign Het
Fat4 A G 3: 39,010,498 R4868G probably damaging Het
Fbxo31 A T 8: 121,555,275 Y295* probably null Het
Fmn2 C A 1: 174,609,838 T1125N possibly damaging Het
Foxi2 C A 7: 135,410,404 P7Q probably damaging Het
Hmx1 C T 5: 35,391,756 P131L probably damaging Het
Hrh2 T C 13: 54,214,152 L49P probably damaging Het
Igkv6-14 A G 6: 70,435,141 V53A possibly damaging Het
Kcnb2 C A 1: 15,710,652 Q583K probably benign Het
Kcns3 A G 12: 11,091,691 S336P probably damaging Het
Kremen2 G T 17: 23,742,746 F262L probably damaging Het
Krtap9-1 T A 11: 99,873,751 C104* probably null Het
Ky A G 9: 102,527,903 Y199C probably damaging Het
L1td1 T G 4: 98,733,978 L259R probably damaging Het
Lrba A G 3: 86,353,755 T1473A probably benign Het
Lrp6 A T 6: 134,507,661 L333* probably null Het
Lrrc23 T C 6: 124,776,080 N201S probably benign Het
Map4k4 C A 1: 40,003,982 P666T possibly damaging Het
Matn1 T A 4: 130,952,203 D389E probably damaging Het
Mdc1 G T 17: 35,847,583 G285V probably benign Het
Mettl17 T C 14: 51,890,730 probably null Het
Neurod1 A T 2: 79,454,086 F318I possibly damaging Het
Nfya T C 17: 48,392,417 T213A probably damaging Het
Nmrk1 C T 19: 18,639,538 T17M probably damaging Het
Ntrk1 A C 3: 87,786,089 D245E probably benign Het
Nup160 C A 2: 90,733,201 H1370Q possibly damaging Het
Olfr1151 T C 2: 87,857,817 V214A probably benign Het
Olfr745 A C 14: 50,643,246 K316Q probably benign Het
Olfr986 T A 9: 40,187,367 V84E probably damaging Het
Parp4 G A 14: 56,629,099 R1040H probably benign Het
Pdia4 C A 6: 47,808,266 E56* probably null Het
Pdia5 A G 16: 35,449,414 F175S probably damaging Het
Piezo2 C T 18: 63,109,885 S621N probably benign Het
Pigw T C 11: 84,877,817 T229A possibly damaging Het
Rasa3 T C 8: 13,576,381 Y734C probably benign Het
Rims1 T C 1: 22,594,100 D178G possibly damaging Het
Rps7 A G 12: 28,631,715 I139T probably benign Het
Sall3 T C 18: 80,986,493 D15G possibly damaging Het
Scn1a A T 2: 66,303,639 V137D probably benign Het
Slc23a3 G A 1: 75,129,529 P349S probably benign Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Stard13 A T 5: 151,063,142 M301K probably benign Het
Suclg2 A G 6: 95,655,508 F60S probably damaging Het
Tecpr2 T A 12: 110,938,234 F887L possibly damaging Het
Tekt4 G T 17: 25,472,059 W113L probably damaging Het
Tep1 G A 14: 50,847,623 S901F probably damaging Het
Tex11 C T X: 101,015,585 V190I possibly damaging Het
Thbs1 T A 2: 118,119,476 probably null Het
Tm9sf4 T A 2: 153,198,375 V425D probably damaging Het
Tpo A G 12: 30,055,138 L911P possibly damaging Het
Ttn T C 2: 76,898,957 Q5332R unknown Het
Wdr59 A T 8: 111,496,834 D169E Het
Zfp799 C A 17: 32,820,192 G367C probably damaging Het
Other mutations in Creb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Creb3 APN 4 43565517 missense probably benign
IGL02641:Creb3 APN 4 43563311 missense probably benign 0.00
IGL03101:Creb3 APN 4 43563081 missense probably benign 0.11
IGL03163:Creb3 APN 4 43566315 missense probably damaging 1.00
P0014:Creb3 UTSW 4 43563265 missense possibly damaging 0.53
PIT4362001:Creb3 UTSW 4 43565472 nonsense probably null
R0959:Creb3 UTSW 4 43563509 missense probably damaging 1.00
R1506:Creb3 UTSW 4 43566193 missense possibly damaging 0.95
R1624:Creb3 UTSW 4 43566375 missense possibly damaging 0.67
R1693:Creb3 UTSW 4 43566755 missense probably damaging 1.00
R1794:Creb3 UTSW 4 43563302 missense probably benign 0.06
R1956:Creb3 UTSW 4 43563279 critical splice acceptor site probably null
R1991:Creb3 UTSW 4 43565327 missense probably damaging 1.00
R2179:Creb3 UTSW 4 43566306 missense probably damaging 1.00
R3811:Creb3 UTSW 4 43565501 nonsense probably null
R4673:Creb3 UTSW 4 43563192 missense probably benign 0.20
R4713:Creb3 UTSW 4 43563247 missense probably benign 0.00
R5613:Creb3 UTSW 4 43566196 missense probably benign 0.41
R6195:Creb3 UTSW 4 43566346 missense probably benign 0.23
R7673:Creb3 UTSW 4 43563117 missense not run
R7829:Creb3 UTSW 4 43566322 missense probably damaging 1.00
R7872:Creb3 UTSW 4 43563332 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACTGGACAGCTCAGAACATATG -3'
(R):5'- ATTCACGGGGCAACAGATAC -3'

Sequencing Primer
(F):5'- AACATATGTTCTTGGTCTCCAGCAAC -3'
(R):5'- TTCACGGGGCAACAGATACATATG -3'
Posted On2021-03-08