Incidental Mutation 'R8726:Camkk2'
ID662417
Institutional Source Beutler Lab
Gene Symbol Camkk2
Ensembl Gene ENSMUSG00000029471
Gene Namecalcium/calmodulin-dependent protein kinase kinase 2, beta
Synonyms6330570N16Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R8726 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location122731170-122779409 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 122743939 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 418 (D418E)
Ref Sequence ENSEMBL: ENSMUSP00000107297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111668] [ENSMUST00000197373] [ENSMUST00000198029] [ENSMUST00000200109]
Predicted Effect probably benign
Transcript: ENSMUST00000111668
AA Change: D418E

PolyPhen 2 Score 0.189 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000107297
Gene: ENSMUSG00000029471
AA Change: D418E

DomainStartEndE-ValueType
low complexity region 124 144 N/A INTRINSIC
S_TKc 165 446 1.53e-92 SMART
low complexity region 464 472 N/A INTRINSIC
low complexity region 526 539 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000197373
AA Change: D18E

PolyPhen 2 Score 0.525 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000142717
Gene: ENSMUSG00000029471
AA Change: D18E

DomainStartEndE-ValueType
SCOP:d1phk__ 1 41 3e-8 SMART
PDB:2ZV2|A 1 42 8e-20 PDB
Blast:S_TKc 1 48 4e-23 BLAST
low complexity region 91 109 N/A INTRINSIC
low complexity region 123 135 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198029
AA Change: D213E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000142896
Gene: ENSMUSG00000029471
AA Change: D213E

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
S_TKc 18 235 8.2e-12 SMART
low complexity region 259 267 N/A INTRINSIC
low complexity region 340 350 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199179
Predicted Effect probably benign
Transcript: ENSMUST00000200109
AA Change: D418E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000143732
Gene: ENSMUSG00000029471
AA Change: D418E

DomainStartEndE-ValueType
low complexity region 124 144 N/A INTRINSIC
S_TKc 165 446 1.53e-92 SMART
low complexity region 464 472 N/A INTRINSIC
low complexity region 526 539 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the Serine/Threonine protein kinase family, and to the Ca(2+)/calmodulin-dependent protein kinase subfamily. The major isoform of this gene plays a role in the calcium/calmodulin-dependent (CaM) kinase cascade by phosphorylating the downstream kinases CaMK1 and CaMK4. Protein products of this gene also phosphorylate AMP-activated protein kinase (AMPK). This gene has its strongest expression in the brain and influences signalling cascades involved with learning and memory, neuronal differentiation and migration, neurite outgrowth, and synapse formation. Alternative splicing results in multiple transcript variants encoding distinct isoforms. The identified isoforms differ in their ability to undergo autophosphorylation and to phosphorylate downstream kinases. [provided by RefSeq, Jul 2012]
PHENOTYPE: Inactivation of this locus results in impaird long term potentiation and defects in some types of long term memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik A G 11: 69,898,381 S331P possibly damaging Het
4930433I11Rik A G 7: 40,994,802 M632V probably benign Het
9930111J21Rik2 A C 11: 49,019,680 V642G probably damaging Het
Acsbg1 T C 9: 54,618,178 E363G probably damaging Het
Ank3 T A 10: 69,987,254 H584Q Het
Ankrd11 A T 8: 122,894,026 L1029Q possibly damaging Het
Anpep C T 7: 79,840,893 V292I probably benign Het
Atmin G A 8: 116,954,786 D175N possibly damaging Het
B4galt6 T C 18: 20,688,393 I359M possibly damaging Het
Bicd2 A G 13: 49,379,429 D497G probably damaging Het
Cntn3 A T 6: 102,169,053 Y942* probably null Het
Col8a1 C T 16: 57,628,775 R124H probably damaging Het
Coro7 T C 16: 4,668,755 T185A possibly damaging Het
Creb3 C T 4: 43,566,747 P364S probably benign Het
Csf1r A T 18: 61,117,656 T480S probably benign Het
Csnk1g1 T A 9: 66,002,271 H223Q probably damaging Het
Ctns C T 11: 73,187,787 V171M probably benign Het
Dhx15 A T 5: 52,154,226 N637K probably benign Het
Eif4g1 T C 16: 20,675,482 Y103H probably damaging Het
Eif4g2 C T 7: 111,077,422 R295H probably damaging Het
Fam126b T C 1: 58,546,126 T171A possibly damaging Het
Fat1 C T 8: 45,024,169 P2084L probably benign Het
Fat4 A G 3: 39,010,498 R4868G probably damaging Het
Fbxo31 A T 8: 121,555,275 Y295* probably null Het
Fmn2 C A 1: 174,609,838 T1125N possibly damaging Het
Foxi2 C A 7: 135,410,404 P7Q probably damaging Het
Hmx1 C T 5: 35,391,756 P131L probably damaging Het
Hrh2 T C 13: 54,214,152 L49P probably damaging Het
Igkv6-14 A G 6: 70,435,141 V53A possibly damaging Het
Kcnb2 C A 1: 15,710,652 Q583K probably benign Het
Kcns3 A G 12: 11,091,691 S336P probably damaging Het
Kremen2 G T 17: 23,742,746 F262L probably damaging Het
Krtap9-1 T A 11: 99,873,751 C104* probably null Het
Ky A G 9: 102,527,903 Y199C probably damaging Het
L1td1 T G 4: 98,733,978 L259R probably damaging Het
Lrba A G 3: 86,353,755 T1473A probably benign Het
Lrp6 A T 6: 134,507,661 L333* probably null Het
Lrrc23 T C 6: 124,776,080 N201S probably benign Het
Map4k4 C A 1: 40,003,982 P666T possibly damaging Het
Matn1 T A 4: 130,952,203 D389E probably damaging Het
Mdc1 G T 17: 35,847,583 G285V probably benign Het
Mettl17 T C 14: 51,890,730 probably null Het
Neurod1 A T 2: 79,454,086 F318I possibly damaging Het
Nfya T C 17: 48,392,417 T213A probably damaging Het
Nmrk1 C T 19: 18,639,538 T17M probably damaging Het
Ntrk1 A C 3: 87,786,089 D245E probably benign Het
Nup160 C A 2: 90,733,201 H1370Q possibly damaging Het
Olfr1151 T C 2: 87,857,817 V214A probably benign Het
Olfr745 A C 14: 50,643,246 K316Q probably benign Het
Olfr986 T A 9: 40,187,367 V84E probably damaging Het
Parp4 G A 14: 56,629,099 R1040H probably benign Het
Pdia4 C A 6: 47,808,266 E56* probably null Het
Pdia5 A G 16: 35,449,414 F175S probably damaging Het
Piezo2 C T 18: 63,109,885 S621N probably benign Het
Pigw T C 11: 84,877,817 T229A possibly damaging Het
Rasa3 T C 8: 13,576,381 Y734C probably benign Het
Rims1 T C 1: 22,594,100 D178G possibly damaging Het
Rps7 A G 12: 28,631,715 I139T probably benign Het
Sall3 T C 18: 80,986,493 D15G possibly damaging Het
Scn1a A T 2: 66,303,639 V137D probably benign Het
Slc23a3 G A 1: 75,129,529 P349S probably benign Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Stard13 A T 5: 151,063,142 M301K probably benign Het
Suclg2 A G 6: 95,655,508 F60S probably damaging Het
Tecpr2 T A 12: 110,938,234 F887L possibly damaging Het
Tekt4 G T 17: 25,472,059 W113L probably damaging Het
Tep1 G A 14: 50,847,623 S901F probably damaging Het
Tex11 C T X: 101,015,585 V190I possibly damaging Het
Thbs1 T A 2: 118,119,476 probably null Het
Tm9sf4 T A 2: 153,198,375 V425D probably damaging Het
Tpo A G 12: 30,055,138 L911P possibly damaging Het
Ttn T C 2: 76,898,957 Q5332R unknown Het
Wdr59 A T 8: 111,496,834 D169E Het
Zfp799 C A 17: 32,820,192 G367C probably damaging Het
Other mutations in Camkk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01866:Camkk2 APN 5 122763950 missense probably damaging 1.00
IGL02321:Camkk2 APN 5 122764127 missense probably damaging 0.96
IGL02619:Camkk2 APN 5 122764235 missense probably damaging 0.98
IGL03356:Camkk2 APN 5 122743874 missense probably damaging 1.00
R0056:Camkk2 UTSW 5 122742198 missense probably damaging 1.00
R0078:Camkk2 UTSW 5 122757559 critical splice donor site probably null
R0344:Camkk2 UTSW 5 122763877 missense probably benign
R1480:Camkk2 UTSW 5 122734278 splice site probably null
R1591:Camkk2 UTSW 5 122757558 critical splice donor site probably null
R1816:Camkk2 UTSW 5 122734180 missense probably damaging 1.00
R1960:Camkk2 UTSW 5 122737512 nonsense probably null
R1985:Camkk2 UTSW 5 122764127 missense possibly damaging 0.81
R2256:Camkk2 UTSW 5 122746335 missense probably damaging 1.00
R4297:Camkk2 UTSW 5 122745706 critical splice donor site probably null
R4687:Camkk2 UTSW 5 122753724 missense probably damaging 1.00
R5401:Camkk2 UTSW 5 122746335 missense probably damaging 1.00
R5802:Camkk2 UTSW 5 122734244 missense probably damaging 0.99
R6167:Camkk2 UTSW 5 122764124 missense probably damaging 0.96
R6508:Camkk2 UTSW 5 122746319 missense probably damaging 0.96
R7313:Camkk2 UTSW 5 122737511 missense possibly damaging 0.55
R7504:Camkk2 UTSW 5 122746308 missense probably damaging 1.00
R7626:Camkk2 UTSW 5 122764300 splice site probably benign
R7664:Camkk2 UTSW 5 122756582 missense unknown
R7698:Camkk2 UTSW 5 122746419 missense probably damaging 0.96
R7805:Camkk2 UTSW 5 122742212 missense possibly damaging 0.92
R7937:Camkk2 UTSW 5 122764034 missense probably benign 0.01
R8289:Camkk2 UTSW 5 122756626 missense probably damaging 1.00
R8852:Camkk2 UTSW 5 122753757 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACAGCGGATATAACCAGC -3'
(R):5'- TGCCCTTTCATGGATGAACG -3'

Sequencing Primer
(F):5'- CCAGAGGCTCCAGGATGTG -3'
(R):5'- TGAACGAATCATGTGTTTGCAC -3'
Posted On2021-03-08