Incidental Mutation 'R8726:Cntn3'
ID662422
Institutional Source Beutler Lab
Gene Symbol Cntn3
Ensembl Gene ENSMUSG00000030075
Gene Namecontactin 3
SynonymsPang
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8726 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location102162655-102573101 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 102169053 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 942 (Y942*)
Ref Sequence ENSEMBL: ENSMUSP00000145176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032159] [ENSMUST00000203619]
Predicted Effect probably null
Transcript: ENSMUST00000032159
AA Change: Y942*
SMART Domains Protein: ENSMUSP00000032159
Gene: ENSMUSG00000030075
AA Change: Y942*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 1.85e-7 SMART
IG 129 217 1.82e-6 SMART
IGc2 240 304 6.8e-15 SMART
IGc2 330 393 1.74e-12 SMART
IGc2 422 486 1.53e-8 SMART
IG 506 595 5.2e-11 SMART
FN3 598 684 3.4e-13 SMART
FN3 701 787 5.36e-2 SMART
FN3 803 888 4.63e-6 SMART
FN3 903 983 1.07e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000203619
AA Change: Y942*
SMART Domains Protein: ENSMUSP00000145176
Gene: ENSMUSG00000030075
AA Change: Y942*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 1.85e-7 SMART
IG 129 217 1.82e-6 SMART
IGc2 240 304 6.8e-15 SMART
IGc2 330 393 1.74e-12 SMART
IGc2 422 486 1.53e-8 SMART
IG 506 595 5.2e-11 SMART
FN3 598 684 3.4e-13 SMART
FN3 701 787 5.36e-2 SMART
FN3 803 888 4.63e-6 SMART
FN3 903 983 1.07e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik A G 11: 69,898,381 S331P possibly damaging Het
4930433I11Rik A G 7: 40,994,802 M632V probably benign Het
9930111J21Rik2 A C 11: 49,019,680 V642G probably damaging Het
Acsbg1 T C 9: 54,618,178 E363G probably damaging Het
Ank3 T A 10: 69,987,254 H584Q Het
Ankrd11 A T 8: 122,894,026 L1029Q possibly damaging Het
Anpep C T 7: 79,840,893 V292I probably benign Het
Atmin G A 8: 116,954,786 D175N possibly damaging Het
B4galt6 T C 18: 20,688,393 I359M possibly damaging Het
Bicd2 A G 13: 49,379,429 D497G probably damaging Het
Camkk2 G T 5: 122,743,939 D418E probably benign Het
Col8a1 C T 16: 57,628,775 R124H probably damaging Het
Coro7 T C 16: 4,668,755 T185A possibly damaging Het
Creb3 C T 4: 43,566,747 P364S probably benign Het
Csf1r A T 18: 61,117,656 T480S probably benign Het
Csnk1g1 T A 9: 66,002,271 H223Q probably damaging Het
Ctns C T 11: 73,187,787 V171M probably benign Het
Dhx15 A T 5: 52,154,226 N637K probably benign Het
Eif4g1 T C 16: 20,675,482 Y103H probably damaging Het
Eif4g2 C T 7: 111,077,422 R295H probably damaging Het
Fam126b T C 1: 58,546,126 T171A possibly damaging Het
Fat1 C T 8: 45,024,169 P2084L probably benign Het
Fat4 A G 3: 39,010,498 R4868G probably damaging Het
Fbxo31 A T 8: 121,555,275 Y295* probably null Het
Fmn2 C A 1: 174,609,838 T1125N possibly damaging Het
Foxi2 C A 7: 135,410,404 P7Q probably damaging Het
Hmx1 C T 5: 35,391,756 P131L probably damaging Het
Hrh2 T C 13: 54,214,152 L49P probably damaging Het
Igkv6-14 A G 6: 70,435,141 V53A possibly damaging Het
Kcnb2 C A 1: 15,710,652 Q583K probably benign Het
Kcns3 A G 12: 11,091,691 S336P probably damaging Het
Kremen2 G T 17: 23,742,746 F262L probably damaging Het
Krtap9-1 T A 11: 99,873,751 C104* probably null Het
Ky A G 9: 102,527,903 Y199C probably damaging Het
L1td1 T G 4: 98,733,978 L259R probably damaging Het
Lrba A G 3: 86,353,755 T1473A probably benign Het
Lrp6 A T 6: 134,507,661 L333* probably null Het
Lrrc23 T C 6: 124,776,080 N201S probably benign Het
Map4k4 C A 1: 40,003,982 P666T possibly damaging Het
Matn1 T A 4: 130,952,203 D389E probably damaging Het
Mdc1 G T 17: 35,847,583 G285V probably benign Het
Mettl17 T C 14: 51,890,730 probably null Het
Neurod1 A T 2: 79,454,086 F318I possibly damaging Het
Nfya T C 17: 48,392,417 T213A probably damaging Het
Nmrk1 C T 19: 18,639,538 T17M probably damaging Het
Ntrk1 A C 3: 87,786,089 D245E probably benign Het
Nup160 C A 2: 90,733,201 H1370Q possibly damaging Het
Olfr1151 T C 2: 87,857,817 V214A probably benign Het
Olfr745 A C 14: 50,643,246 K316Q probably benign Het
Olfr986 T A 9: 40,187,367 V84E probably damaging Het
Parp4 G A 14: 56,629,099 R1040H probably benign Het
Pdia4 C A 6: 47,808,266 E56* probably null Het
Pdia5 A G 16: 35,449,414 F175S probably damaging Het
Piezo2 C T 18: 63,109,885 S621N probably benign Het
Pigw T C 11: 84,877,817 T229A possibly damaging Het
Rasa3 T C 8: 13,576,381 Y734C probably benign Het
Rims1 T C 1: 22,594,100 D178G possibly damaging Het
Rps7 A G 12: 28,631,715 I139T probably benign Het
Sall3 T C 18: 80,986,493 D15G possibly damaging Het
Scn1a A T 2: 66,303,639 V137D probably benign Het
Slc23a3 G A 1: 75,129,529 P349S probably benign Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Stard13 A T 5: 151,063,142 M301K probably benign Het
Suclg2 A G 6: 95,655,508 F60S probably damaging Het
Tecpr2 T A 12: 110,938,234 F887L possibly damaging Het
Tekt4 G T 17: 25,472,059 W113L probably damaging Het
Tep1 G A 14: 50,847,623 S901F probably damaging Het
Tex11 C T X: 101,015,585 V190I possibly damaging Het
Thbs1 T A 2: 118,119,476 probably null Het
Tm9sf4 T A 2: 153,198,375 V425D probably damaging Het
Tpo A G 12: 30,055,138 L911P possibly damaging Het
Ttn T C 2: 76,898,957 Q5332R unknown Het
Wdr59 A T 8: 111,496,834 D169E Het
Zfp799 C A 17: 32,820,192 G367C probably damaging Het
Other mutations in Cntn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Cntn3 APN 6 102420262 nonsense probably null
IGL00706:Cntn3 APN 6 102203949 missense probably benign 0.11
IGL01071:Cntn3 APN 6 102420251 critical splice donor site probably null
IGL01769:Cntn3 APN 6 102208184 missense probably damaging 1.00
IGL01995:Cntn3 APN 6 102203885 missense probably damaging 1.00
IGL02058:Cntn3 APN 6 102199360 splice site probably benign
IGL02736:Cntn3 APN 6 102203939 missense probably damaging 1.00
IGL02955:Cntn3 APN 6 102278301 missense probably damaging 1.00
IGL02971:Cntn3 APN 6 102168933 missense probably damaging 1.00
IGL03208:Cntn3 APN 6 102187099 missense probably damaging 0.99
P0037:Cntn3 UTSW 6 102209274 missense probably damaging 1.00
PIT4431001:Cntn3 UTSW 6 102464566 missense probably benign 0.22
R0314:Cntn3 UTSW 6 102420381 missense probably damaging 1.00
R0388:Cntn3 UTSW 6 102277316 missense probably damaging 0.96
R0483:Cntn3 UTSW 6 102203966 missense probably damaging 1.00
R0539:Cntn3 UTSW 6 102277217 critical splice donor site probably null
R0543:Cntn3 UTSW 6 102269090 splice site probably benign
R0629:Cntn3 UTSW 6 102203976 missense probably damaging 1.00
R0691:Cntn3 UTSW 6 102168947 missense possibly damaging 0.48
R0693:Cntn3 UTSW 6 102168947 missense possibly damaging 0.48
R0781:Cntn3 UTSW 6 102245158 missense probably benign 0.22
R1110:Cntn3 UTSW 6 102245158 missense probably benign 0.22
R1144:Cntn3 UTSW 6 102242126 missense possibly damaging 0.65
R1503:Cntn3 UTSW 6 102464565 nonsense probably null
R1640:Cntn3 UTSW 6 102242013 missense possibly damaging 0.82
R1681:Cntn3 UTSW 6 102170668 missense probably damaging 1.00
R1770:Cntn3 UTSW 6 102269205 missense possibly damaging 0.49
R1782:Cntn3 UTSW 6 102273811 missense probably damaging 0.97
R1861:Cntn3 UTSW 6 102245071 missense probably benign 0.11
R1930:Cntn3 UTSW 6 102242053 nonsense probably null
R2026:Cntn3 UTSW 6 102420427 missense probably damaging 1.00
R2152:Cntn3 UTSW 6 102206537 missense probably damaging 1.00
R2313:Cntn3 UTSW 6 102203928 missense probably benign
R2351:Cntn3 UTSW 6 102337383 missense possibly damaging 0.55
R3611:Cntn3 UTSW 6 102208077 missense possibly damaging 0.77
R4349:Cntn3 UTSW 6 102199351 missense probably damaging 1.00
R4421:Cntn3 UTSW 6 102464547 missense probably damaging 0.97
R4513:Cntn3 UTSW 6 102168982 missense probably benign 0.37
R4678:Cntn3 UTSW 6 102204020 missense probably damaging 1.00
R4702:Cntn3 UTSW 6 102165331 missense probably benign 0.37
R4720:Cntn3 UTSW 6 102242022 missense possibly damaging 0.65
R4879:Cntn3 UTSW 6 102267428 missense possibly damaging 0.47
R4951:Cntn3 UTSW 6 102169025 missense possibly damaging 0.90
R5410:Cntn3 UTSW 6 102278353 missense probably benign 0.01
R5502:Cntn3 UTSW 6 102265334 missense possibly damaging 0.58
R5852:Cntn3 UTSW 6 102420416 missense probably damaging 1.00
R5903:Cntn3 UTSW 6 102242133 missense probably benign 0.00
R6193:Cntn3 UTSW 6 102208131 missense probably benign 0.31
R6258:Cntn3 UTSW 6 102277217 critical splice donor site probably null
R6260:Cntn3 UTSW 6 102277217 critical splice donor site probably null
R6350:Cntn3 UTSW 6 102170618 missense probably damaging 1.00
R6490:Cntn3 UTSW 6 102278340 missense probably damaging 0.99
R6993:Cntn3 UTSW 6 102278404 missense probably damaging 0.98
R7064:Cntn3 UTSW 6 102273811 missense probably damaging 0.97
R7085:Cntn3 UTSW 6 102165401 missense possibly damaging 0.85
R7174:Cntn3 UTSW 6 102165344 missense probably benign
R7208:Cntn3 UTSW 6 102278422 nonsense probably null
R7395:Cntn3 UTSW 6 102337394 critical splice acceptor site probably null
R7447:Cntn3 UTSW 6 102278455 nonsense probably null
R7571:Cntn3 UTSW 6 102278403 missense probably damaging 1.00
R7586:Cntn3 UTSW 6 102420427 missense probably damaging 1.00
R7614:Cntn3 UTSW 6 102165376 missense probably benign 0.17
R7697:Cntn3 UTSW 6 102208166 missense probably damaging 1.00
R7697:Cntn3 UTSW 6 102208167 missense probably damaging 1.00
R7849:Cntn3 UTSW 6 102265431 missense probably benign 0.00
R8011:Cntn3 UTSW 6 102437899 missense possibly damaging 0.93
R8013:Cntn3 UTSW 6 102199317 missense probably benign 0.00
R8377:Cntn3 UTSW 6 102209293 missense probably benign 0.00
R8770:Cntn3 UTSW 6 102277316 missense possibly damaging 0.67
R8827:Cntn3 UTSW 6 102269133 missense probably benign 0.01
R8947:Cntn3 UTSW 6 102437903 missense probably damaging 1.00
Z1088:Cntn3 UTSW 6 102420294 missense possibly damaging 0.74
Z1176:Cntn3 UTSW 6 102437931 critical splice acceptor site probably null
Z1177:Cntn3 UTSW 6 102337331 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GAGCTCAACCGACTTACTGG -3'
(R):5'- GCCTAACAGAGAGTTTTCCATG -3'

Sequencing Primer
(F):5'- GAGCTCAACCGACTTACTGGTTATTC -3'
(R):5'- GGAAAAAGTTCATTATTCACCCAGC -3'
Posted On2021-03-08