Incidental Mutation 'R8726:Olfr986'
ID662435
Institutional Source Beutler Lab
Gene Symbol Olfr986
Ensembl Gene ENSMUSG00000051095
Gene Nameolfactory receptor 986
SynonymsMOR104-3, GA_x6K02T2PVTD-33886895-33887833
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R8726 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location40180920-40190134 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40187367 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 84 (V84E)
Ref Sequence ENSEMBL: ENSMUSP00000149030 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026693] [ENSMUST00000062229] [ENSMUST00000168691] [ENSMUST00000168832] [ENSMUST00000214763] [ENSMUST00000216720] [ENSMUST00000218134]
Predicted Effect probably benign
Transcript: ENSMUST00000026693
SMART Domains Protein: ENSMUSP00000026693
Gene: ENSMUSG00000025602

DomainStartEndE-ValueType
SCAN 42 154 1.19e-75 SMART
KRAB 237 297 1.7e-17 SMART
ZnF_C2H2 391 413 9.44e-2 SMART
ZnF_C2H2 419 441 6.42e-4 SMART
ZnF_C2H2 473 495 3.44e-4 SMART
ZnF_C2H2 501 523 1.47e-3 SMART
ZnF_C2H2 529 551 1.64e-1 SMART
ZnF_C2H2 557 579 3.11e-2 SMART
ZnF_C2H2 585 607 8.47e-4 SMART
ZnF_C2H2 613 635 3.39e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000062229
AA Change: V84E

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000056713
Gene: ENSMUSG00000051095
AA Change: V84E

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 5.1e-54 PFAM
Pfam:7tm_1 39 288 3.7e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168691
SMART Domains Protein: ENSMUSP00000130163
Gene: ENSMUSG00000025602

DomainStartEndE-ValueType
SCAN 42 132 1.03e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168832
SMART Domains Protein: ENSMUSP00000132131
Gene: ENSMUSG00000025602

DomainStartEndE-ValueType
SCAN 42 154 1.19e-75 SMART
KRAB 237 277 5.32e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000214763
AA Change: V84E

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000216720
AA Change: V84E

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000218134
AA Change: V84E

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik A G 11: 69,898,381 S331P possibly damaging Het
4930433I11Rik A G 7: 40,994,802 M632V probably benign Het
9930111J21Rik2 A C 11: 49,019,680 V642G probably damaging Het
Acsbg1 T C 9: 54,618,178 E363G probably damaging Het
Ank3 T A 10: 69,987,254 H584Q Het
Ankrd11 A T 8: 122,894,026 L1029Q possibly damaging Het
Anpep C T 7: 79,840,893 V292I probably benign Het
Atmin G A 8: 116,954,786 D175N possibly damaging Het
B4galt6 T C 18: 20,688,393 I359M possibly damaging Het
Bicd2 A G 13: 49,379,429 D497G probably damaging Het
Camkk2 G T 5: 122,743,939 D418E probably benign Het
Cntn3 A T 6: 102,169,053 Y942* probably null Het
Col8a1 C T 16: 57,628,775 R124H probably damaging Het
Coro7 T C 16: 4,668,755 T185A possibly damaging Het
Creb3 C T 4: 43,566,747 P364S probably benign Het
Csf1r A T 18: 61,117,656 T480S probably benign Het
Csnk1g1 T A 9: 66,002,271 H223Q probably damaging Het
Ctns C T 11: 73,187,787 V171M probably benign Het
Dhx15 A T 5: 52,154,226 N637K probably benign Het
Eif4g1 T C 16: 20,675,482 Y103H probably damaging Het
Eif4g2 C T 7: 111,077,422 R295H probably damaging Het
Fam126b T C 1: 58,546,126 T171A possibly damaging Het
Fat1 C T 8: 45,024,169 P2084L probably benign Het
Fat4 A G 3: 39,010,498 R4868G probably damaging Het
Fbxo31 A T 8: 121,555,275 Y295* probably null Het
Fmn2 C A 1: 174,609,838 T1125N possibly damaging Het
Foxi2 C A 7: 135,410,404 P7Q probably damaging Het
Hmx1 C T 5: 35,391,756 P131L probably damaging Het
Hrh2 T C 13: 54,214,152 L49P probably damaging Het
Igkv6-14 A G 6: 70,435,141 V53A possibly damaging Het
Kcnb2 C A 1: 15,710,652 Q583K probably benign Het
Kcns3 A G 12: 11,091,691 S336P probably damaging Het
Kremen2 G T 17: 23,742,746 F262L probably damaging Het
Krtap9-1 T A 11: 99,873,751 C104* probably null Het
Ky A G 9: 102,527,903 Y199C probably damaging Het
L1td1 T G 4: 98,733,978 L259R probably damaging Het
Lrba A G 3: 86,353,755 T1473A probably benign Het
Lrp6 A T 6: 134,507,661 L333* probably null Het
Lrrc23 T C 6: 124,776,080 N201S probably benign Het
Map4k4 C A 1: 40,003,982 P666T possibly damaging Het
Matn1 T A 4: 130,952,203 D389E probably damaging Het
Mdc1 G T 17: 35,847,583 G285V probably benign Het
Mettl17 T C 14: 51,890,730 probably null Het
Neurod1 A T 2: 79,454,086 F318I possibly damaging Het
Nfya T C 17: 48,392,417 T213A probably damaging Het
Nmrk1 C T 19: 18,639,538 T17M probably damaging Het
Ntrk1 A C 3: 87,786,089 D245E probably benign Het
Nup160 C A 2: 90,733,201 H1370Q possibly damaging Het
Olfr1151 T C 2: 87,857,817 V214A probably benign Het
Olfr745 A C 14: 50,643,246 K316Q probably benign Het
Parp4 G A 14: 56,629,099 R1040H probably benign Het
Pdia4 C A 6: 47,808,266 E56* probably null Het
Pdia5 A G 16: 35,449,414 F175S probably damaging Het
Piezo2 C T 18: 63,109,885 S621N probably benign Het
Pigw T C 11: 84,877,817 T229A possibly damaging Het
Rasa3 T C 8: 13,576,381 Y734C probably benign Het
Rims1 T C 1: 22,594,100 D178G possibly damaging Het
Rps7 A G 12: 28,631,715 I139T probably benign Het
Sall3 T C 18: 80,986,493 D15G possibly damaging Het
Scn1a A T 2: 66,303,639 V137D probably benign Het
Slc23a3 G A 1: 75,129,529 P349S probably benign Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Stard13 A T 5: 151,063,142 M301K probably benign Het
Suclg2 A G 6: 95,655,508 F60S probably damaging Het
Tecpr2 T A 12: 110,938,234 F887L possibly damaging Het
Tekt4 G T 17: 25,472,059 W113L probably damaging Het
Tep1 G A 14: 50,847,623 S901F probably damaging Het
Tex11 C T X: 101,015,585 V190I possibly damaging Het
Thbs1 T A 2: 118,119,476 probably null Het
Tm9sf4 T A 2: 153,198,375 V425D probably damaging Het
Tpo A G 12: 30,055,138 L911P possibly damaging Het
Ttn T C 2: 76,898,957 Q5332R unknown Het
Wdr59 A T 8: 111,496,834 D169E Het
Zfp799 C A 17: 32,820,192 G367C probably damaging Het
Other mutations in Olfr986
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Olfr986 APN 9 40187756 missense probably benign 0.01
IGL02342:Olfr986 APN 9 40187527 missense probably benign
IGL02961:Olfr986 APN 9 40187601 missense probably benign 0.00
R0379:Olfr986 UTSW 9 40187433 missense probably damaging 1.00
R1411:Olfr986 UTSW 9 40187139 missense possibly damaging 0.93
R1712:Olfr986 UTSW 9 40187865 missense probably damaging 1.00
R1818:Olfr986 UTSW 9 40187262 missense probably benign
R2249:Olfr986 UTSW 9 40187684 missense possibly damaging 0.59
R3162:Olfr986 UTSW 9 40187605 missense probably benign 0.02
R3162:Olfr986 UTSW 9 40187605 missense probably benign 0.02
R5071:Olfr986 UTSW 9 40187664 missense probably damaging 1.00
R5464:Olfr986 UTSW 9 40187784 missense probably damaging 1.00
R5475:Olfr986 UTSW 9 40187709 missense possibly damaging 0.84
R5695:Olfr986 UTSW 9 40187601 missense probably benign 0.00
R5878:Olfr986 UTSW 9 40187571 missense probably benign 0.02
R6978:Olfr986 UTSW 9 40187789 missense probably damaging 1.00
R7252:Olfr986 UTSW 9 40187361 missense probably benign 0.25
R8040:Olfr986 UTSW 9 40187421 missense probably damaging 0.97
R8410:Olfr986 UTSW 9 40187436 missense possibly damaging 0.93
R8829:Olfr986 UTSW 9 40187913 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- TCAGAAGCCCTTCTCTTCATAGTG -3'
(R):5'- ACAATGGTGAAGCCTGCTAGC -3'

Sequencing Primer
(F):5'- AGCCCTTCTCTTCATAGTGATCTTTC -3'
(R):5'- TGAGGGCCAGCTGTAGG -3'
Posted On2021-03-08