Incidental Mutation 'R8726:Tpo'
ID662447
Institutional Source Beutler Lab
Gene Symbol Tpo
Ensembl Gene ENSMUSG00000020673
Gene Namethyroid peroxidase
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.525) question?
Stock #R8726 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location30054659-30132624 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30055138 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 911 (L911P)
Ref Sequence ENSEMBL: ENSMUSP00000021005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021005]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021005
AA Change: L911P

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000021005
Gene: ENSMUSG00000020673
AA Change: L911P

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
Pfam:An_peroxidase 145 697 4.2e-180 PFAM
CCP 730 782 1.26e-7 SMART
EGF_CA 784 827 3.51e-10 SMART
transmembrane domain 837 859 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138626
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a membrane-bound glycoprotein. The encoded enzyme plays a central role in thyroid gland function. The enzyme functions in the iodination of tyrosine residues in thyroglobulin and phenoxy-ester formation between pairs of iodinated tyrosines to generate the thyroid hormones, thyroxine and triiodothyronine. Mice with homozygous missense mutations in this gene exhibit hypothyroid dwarfism and hearing impairment. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous mice with a missense mutation exhibit hypothyroid dwarfism, including a goiter with colloid deficiency and abnormal follicle epithelium, reduced hematocrit and red blood cells and a lifespan of about 3 months. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik A G 11: 69,898,381 S331P possibly damaging Het
4930433I11Rik A G 7: 40,994,802 M632V probably benign Het
9930111J21Rik2 A C 11: 49,019,680 V642G probably damaging Het
Acsbg1 T C 9: 54,618,178 E363G probably damaging Het
Ank3 T A 10: 69,987,254 H584Q Het
Ankrd11 A T 8: 122,894,026 L1029Q possibly damaging Het
Anpep C T 7: 79,840,893 V292I probably benign Het
Atmin G A 8: 116,954,786 D175N possibly damaging Het
B4galt6 T C 18: 20,688,393 I359M possibly damaging Het
Bicd2 A G 13: 49,379,429 D497G probably damaging Het
Camkk2 G T 5: 122,743,939 D418E probably benign Het
Cntn3 A T 6: 102,169,053 Y942* probably null Het
Col8a1 C T 16: 57,628,775 R124H probably damaging Het
Coro7 T C 16: 4,668,755 T185A possibly damaging Het
Creb3 C T 4: 43,566,747 P364S probably benign Het
Csf1r A T 18: 61,117,656 T480S probably benign Het
Csnk1g1 T A 9: 66,002,271 H223Q probably damaging Het
Ctns C T 11: 73,187,787 V171M probably benign Het
Dhx15 A T 5: 52,154,226 N637K probably benign Het
Eif4g1 T C 16: 20,675,482 Y103H probably damaging Het
Eif4g2 C T 7: 111,077,422 R295H probably damaging Het
Fam126b T C 1: 58,546,126 T171A possibly damaging Het
Fat1 C T 8: 45,024,169 P2084L probably benign Het
Fat4 A G 3: 39,010,498 R4868G probably damaging Het
Fbxo31 A T 8: 121,555,275 Y295* probably null Het
Fmn2 C A 1: 174,609,838 T1125N possibly damaging Het
Foxi2 C A 7: 135,410,404 P7Q probably damaging Het
Hmx1 C T 5: 35,391,756 P131L probably damaging Het
Hrh2 T C 13: 54,214,152 L49P probably damaging Het
Igkv6-14 A G 6: 70,435,141 V53A possibly damaging Het
Kcnb2 C A 1: 15,710,652 Q583K probably benign Het
Kcns3 A G 12: 11,091,691 S336P probably damaging Het
Kremen2 G T 17: 23,742,746 F262L probably damaging Het
Krtap9-1 T A 11: 99,873,751 C104* probably null Het
Ky A G 9: 102,527,903 Y199C probably damaging Het
L1td1 T G 4: 98,733,978 L259R probably damaging Het
Lrba A G 3: 86,353,755 T1473A probably benign Het
Lrp6 A T 6: 134,507,661 L333* probably null Het
Lrrc23 T C 6: 124,776,080 N201S probably benign Het
Map4k4 C A 1: 40,003,982 P666T possibly damaging Het
Matn1 T A 4: 130,952,203 D389E probably damaging Het
Mdc1 G T 17: 35,847,583 G285V probably benign Het
Mettl17 T C 14: 51,890,730 probably null Het
Neurod1 A T 2: 79,454,086 F318I possibly damaging Het
Nfya T C 17: 48,392,417 T213A probably damaging Het
Nmrk1 C T 19: 18,639,538 T17M probably damaging Het
Ntrk1 A C 3: 87,786,089 D245E probably benign Het
Nup160 C A 2: 90,733,201 H1370Q possibly damaging Het
Olfr1151 T C 2: 87,857,817 V214A probably benign Het
Olfr745 A C 14: 50,643,246 K316Q probably benign Het
Olfr986 T A 9: 40,187,367 V84E probably damaging Het
Parp4 G A 14: 56,629,099 R1040H probably benign Het
Pdia4 C A 6: 47,808,266 E56* probably null Het
Pdia5 A G 16: 35,449,414 F175S probably damaging Het
Piezo2 C T 18: 63,109,885 S621N probably benign Het
Pigw T C 11: 84,877,817 T229A possibly damaging Het
Rasa3 T C 8: 13,576,381 Y734C probably benign Het
Rims1 T C 1: 22,594,100 D178G possibly damaging Het
Rps7 A G 12: 28,631,715 I139T probably benign Het
Sall3 T C 18: 80,986,493 D15G possibly damaging Het
Scn1a A T 2: 66,303,639 V137D probably benign Het
Slc23a3 G A 1: 75,129,529 P349S probably benign Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Stard13 A T 5: 151,063,142 M301K probably benign Het
Suclg2 A G 6: 95,655,508 F60S probably damaging Het
Tecpr2 T A 12: 110,938,234 F887L possibly damaging Het
Tekt4 G T 17: 25,472,059 W113L probably damaging Het
Tep1 G A 14: 50,847,623 S901F probably damaging Het
Tex11 C T X: 101,015,585 V190I possibly damaging Het
Thbs1 T A 2: 118,119,476 probably null Het
Tm9sf4 T A 2: 153,198,375 V425D probably damaging Het
Ttn T C 2: 76,898,957 Q5332R unknown Het
Wdr59 A T 8: 111,496,834 D169E Het
Zfp799 C A 17: 32,820,192 G367C probably damaging Het
Other mutations in Tpo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Tpo APN 12 30084620 missense probably damaging 1.00
IGL00694:Tpo APN 12 30105994 missense probably damaging 0.98
IGL01660:Tpo APN 12 30119400 splice site probably benign
IGL01939:Tpo APN 12 30084647 missense possibly damaging 0.83
IGL02624:Tpo APN 12 30100414 missense probably benign 0.40
IGL03268:Tpo APN 12 30094965 missense possibly damaging 0.82
IGL03330:Tpo APN 12 30103501 missense probably damaging 0.97
IGL03138:Tpo UTSW 12 30074171 missense probably benign 0.00
R0025:Tpo UTSW 12 30100390 missense probably benign 0.03
R0025:Tpo UTSW 12 30100390 missense probably benign 0.03
R0076:Tpo UTSW 12 30104023 missense probably damaging 1.00
R0472:Tpo UTSW 12 30100486 missense probably benign 0.03
R1389:Tpo UTSW 12 30103110 missense probably damaging 0.98
R1493:Tpo UTSW 12 30131809 missense possibly damaging 0.78
R1526:Tpo UTSW 12 30084695 missense probably damaging 0.99
R1674:Tpo UTSW 12 30100568 missense probably benign 0.16
R1689:Tpo UTSW 12 30098246 missense probably damaging 1.00
R1986:Tpo UTSW 12 30119466 missense probably damaging 1.00
R2381:Tpo UTSW 12 30131827 missense possibly damaging 0.67
R2484:Tpo UTSW 12 30103969 missense probably benign 0.12
R2902:Tpo UTSW 12 30119449 missense possibly damaging 0.91
R4105:Tpo UTSW 12 30092586 missense probably damaging 0.98
R4106:Tpo UTSW 12 30092586 missense probably damaging 0.98
R4107:Tpo UTSW 12 30092586 missense probably damaging 0.98
R4108:Tpo UTSW 12 30092586 missense probably damaging 0.98
R4109:Tpo UTSW 12 30092586 missense probably damaging 0.98
R4374:Tpo UTSW 12 30103152 missense possibly damaging 0.50
R4425:Tpo UTSW 12 30104016 missense probably damaging 1.00
R4600:Tpo UTSW 12 30098229 missense probably benign 0.32
R4668:Tpo UTSW 12 30103290 missense probably benign 0.03
R4758:Tpo UTSW 12 30075871 missense probably damaging 1.00
R4838:Tpo UTSW 12 30092634 missense probably damaging 1.00
R4869:Tpo UTSW 12 30103365 missense probably benign 0.00
R5163:Tpo UTSW 12 30105980 missense probably benign 0.00
R5223:Tpo UTSW 12 30092590 missense probably damaging 0.99
R5367:Tpo UTSW 12 30103290 missense probably damaging 1.00
R5658:Tpo UTSW 12 30055138 missense possibly damaging 0.95
R5660:Tpo UTSW 12 30100496 missense possibly damaging 0.92
R5671:Tpo UTSW 12 30119491 missense probably benign 0.00
R6019:Tpo UTSW 12 30094981 missense possibly damaging 0.94
R6074:Tpo UTSW 12 30078187 missense probably benign 0.15
R6181:Tpo UTSW 12 30131885 missense probably benign 0.37
R6321:Tpo UTSW 12 30103108 missense probably damaging 1.00
R6433:Tpo UTSW 12 30084754 missense probably benign
R7206:Tpo UTSW 12 30103134 missense possibly damaging 0.76
R7234:Tpo UTSW 12 30092686 missense probably benign 0.00
R7473:Tpo UTSW 12 30092590 missense probably benign 0.15
R7571:Tpo UTSW 12 30119432 missense probably benign 0.00
R7709:Tpo UTSW 12 30131860 missense possibly damaging 0.62
R7844:Tpo UTSW 12 30100405 missense probably damaging 1.00
R7859:Tpo UTSW 12 30100574 missense probably damaging 1.00
R7883:Tpo UTSW 12 30103170 missense probably damaging 1.00
R8138:Tpo UTSW 12 30074104 missense probably benign 0.00
R8171:Tpo UTSW 12 30104046 missense probably damaging 1.00
R8877:Tpo UTSW 12 30092739 missense probably damaging 0.99
X0050:Tpo UTSW 12 30078094 missense probably damaging 1.00
Z1088:Tpo UTSW 12 30094782 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGCATCCATTAGCCTTAGTGC -3'
(R):5'- GAAGTGAAGGCTCTGCTCTG -3'

Sequencing Primer
(F):5'- CATCCATTAGCCTTAGTGCGTAGG -3'
(R):5'- GCTCTGCTCTGCTAAAGGC -3'
Posted On2021-03-08